RegulonDB RegulonDB 10.8: Gene Sequence
ileS gene sequence


Size: 2817        A: 655  T: 591  G: 824  C: 747

Fasta

 

>ileS E. coli K12. Version NC_000913.3 GI:556503834
atgagtgactataaatcaaccctgaatttgccggaaacagggttcccgatgcgtggcgat
ctcgccaagcgcgaacccggaatgctggcgcgttggactgatgatgatctgtacggcatc
atccgtgcggctaaaaaaggcaaaaaaaccttcattctgcatgatggccctccttatgcg
aatggcagcattcatattggtcactcggttaacaagattctgaaagacattatcgtgaag
tccaaagggctttccggttatgactcgccgtatgtgcctggctgggactgccacggtctg
ccgatcgagctgaaagtcgagcaagaatacggtaagccgggtgagaaattcaccgccgcc
gagttccgcgccaagtgccgcgaatacgcggcgacccaggttgacggtcaacgcaaagac
tttatccgtctgggcgtgctgggcgactggtcgcacccgtacctgaccatggacttcaaa
actgaagccaacatcatccgcgcgctgggcaaaatcatcggcaacggtcacctgcacaaa
ggcgcgaagccagttcactggtgcgttgactgccgttctgcgctggcggaagcggaagtt
gagtattacgacaaaacttctccgtccatcgacgttgctttccaggcagtcgatcaggat
gcactgaaagcaaaatttgccgtaagcaacgttaacggcccaatctcgctggtaatctgg
accaccacgccgtggactctgcctgccaaccgcgcaatctctattgcaccagatttcgac
tatgcgctggtgcagatcgacggtcaggccgtgattctggcgaaagatctggttgaaagc
gtaatgcagcgtatcggcgtgaccgattacaccattctcggcacggtaaaaggtgcggag
cttgagctgctgcgctttacccatccgtttatgggcttcgacgttccggcaatcctcggc
gatcacgttaccctggatgccggtaccggtgccgttcacaccgcgcctggccacggcccg
gacgactatgtgatcggtcagaaatacggcctggaaaccgctaacccggttggcccggac
ggcacttatctgccgggcacttatccgacgctggatggcgtgaacgtcttcaaagcgaac
gacatcgtcgttgcgctgctgcaggaaaaaggcgcgctgctgcacgttgagaaaatgcag
cacagctatccgtgctgctggcgtcacaaaacgccgatcatcttccgcgcgacgccgcag
tggttcgtcagcatggatcagaaaggtctgcgtgcgcagtcactgaaagagatcaaaggc
gtgcagtggatcccggactggggccaggcgcgtatcgagtcgatggttgctaaccgtcct
gactggtgtatctcccgtcagcgcacctggggtgtaccgatgtcactgttcgtgcacaaa
gacacggaagagctgcatccgcgtacccttgaactgatggaagaagtggcaaaacgcgtt
gaagtcgatggcatccaggcgtggtgggatctcgatgcgaaagagatcctcggcgacgaa
gctgatcagtacgtgaaagtgccggacacattggatgtatggtttgactccggatctacc
cactcttctgttgttgacgtgcgtccggaatttgccggtcacgcagcggacatgtatctg
gaaggttctgaccaacaccgcggctggttcatgtcttccctaatgatctccaccgcgatg
aagggtaaagcgccgtatcgtcaggtactgacccacggctttaccgtggatggtcagggc
cgcaagatgtctaaatccatcggcaataccgtttcgccgcaggatgtgatgaacaaactg
ggcgcggatattctgcgtctgtgggtggcatcaaccgactacaccggtgaaatggccgtt
tctgacgagatcctgaaacgtgctgccgatagctatcgtcgtatccgtaacaccgcgcgc
ttcctgctggcaaacctgaacggttttgatccagcaaaagatatggtgaaaccggaagag
atggtggtactggatcgctgggccgtaggttgtgcgaaagcggcacaggaagacatcctc
aaggcgtacgaagcatacgatttccacgaagtggtacagcgtctgatgcgcttctgctcc
gttgagatgggttccttctacctcgacatcatcaaagaccgtcagtacaccgccaaagcg
gacagtgtggcgcgtcgtagctgccagactgcgctatatcacatcgcagaagcgctggtg
cgctggatggcaccaatcctctccttcaccgctgatgaagtgtggggctacctgccgggc
gaacgtgaaaaatacgtcttcaccggtgagtggtacgaaggcctgtttggcctggcagac
agtgaagcgatgaacgatgcgttctgggacgagctgttgaaagtgcgtggcgaagtgaac
aaagtcattgagcaagcgcgtgccgacaagaaagtgggtggctcgctggaagcggcagta
accttgtatgcagaaccggaactgtcggcgaaactgaccgcgctgggcgatgaattacga
tttgtcctgttgacctccggcgctaccgttgcagactataacgacgcacctgctgatgct
cagcagagcgaagtactcaaagggctgaaagtcgcgttgagtaaagccgaaggtgagaag
tgcccacgctgctggcactacacccaggatgtcggcaaggtggcggaacacgcagaaatc
tgcggccgctgtgtcagcaacgtcgccggtgacggtgaaaaacgtaagtttgcctga
              
                            

Download fasta file
RegulonDB