RegulonDB RegulonDB 10.9: Gene Sequence
ilvA gene sequence


Size: 1545        A: 325  T: 312  G: 472  C: 436

Fasta

 

>ilvA E. coli K12. Version NC_000913.3 GI:556503834
atggctgactcgcaacccctgtccggtgctccggaaggtgccgaatatttaagagcagtg
ctgcgcgcgccggtttacgaggcggcgcaggttacgccgctacaaaaaatggaaaaactg
tcgtcgcgtcttgataacgtcattctggtgaagcgcgaagatcgccagccagtgcacagc
tttaagctgcgcggcgcatacgccatgatggcgggcctgacggaagaacagaaagcgcac
ggcgtgatcactgcttctgcgggtaaccacgcgcagggcgtcgcgttttcttctgcgcgg
ttaggcgtgaaggccctgatcgttatgccaaccgccaccgccgacatcaaagtcgacgcg
gtgcgcggcttcggcggcgaagtgctgctccacggcgcgaactttgatgaagcgaaagcc
aaagcgatcgaactgtcacagcagcaggggttcacctgggtgccgccgttcgaccatccg
atggtgattgccgggcaaggcacgctggcgctggaactgctccagcaggacgcccatctc
gaccgcgtatttgtgccagtcggcggcggcggtctggctgctggcgtggcggtgctgatc
aaacaactgatgccgcaaatcaaagtgatcgccgtagaagcggaagactccgcctgcctg
aaagcagcgctggatgcgggtcatccggttgatctgccgcgcgtagggctatttgctgaa
ggcgtagcggtaaaacgcatcggtgacgaaaccttccgtttatgccaggagtatctcgac
gacatcatcaccgtcgatagcgatgcgatctgtgcggcgatgaaggatttattcgaagat
gtgcgcgcggtggcggaaccctctggcgcgctggcgctggcgggaatgaaaaaatatatc
gccctgcacaacattcgcggcgaacggctggcgcatattctttccggtgccaacgtgaac
ttccacggcctgcgctacgtctcagaacgctgcgaactgggcgaacagcgtgaagcgttg
ttggcggtgaccattccggaagaaaaaggcagcttcctcaaattctgccaactgcttggc
gggcgttcggtcaccgagttcaactaccgttttgccgatgccaaaaacgcctgcatcttt
gtcggtgtgcgcctgagccgcggcctcgaagagcgcaaagaaattttgcagatgctcaac
gacggcggctacagcgtggttgatctctccgacgacgaaatggcgaagctacacgtgcgc
tatatggtcggcggacgtccatcgcatccgttgcaggaacgcctctacagcttcgaattc
ccggaatcaccgggcgcgctgctgcgcttcctcaacacgctgggtacgtactggaacatt
tctttgttccactatcgcagccatggcaccgactacgggcgcgtactggcggcgttcgaa
cttggcgaccatgaaccggatttcgaaacccggctgaatgagctgggctacgattgccac
gacgaaaccaataacccggcgttcaggttctttttggcgggttag
              
                            

Download fasta file
RegulonDB