RegulonDB RegulonDB 10.9: Gene Sequence
ilvD gene sequence


Size: 1851        A: 420  T: 388  G: 537  C: 506

Fasta

 

>ilvD E. coli K12. Version NC_000913.3 GI:556503834
atgcctaagtaccgttccgccaccaccactcatggtcgtaatatggcgggtgctcgtgcg
ctgtggcgcgccaccggaatgaccgacgccgatttcggtaagccgattatcgcggttgtg
aactcgttcacccaatttgtaccgggtcacgtccatctgcgcgatctcggtaaactggtc
gccgaacaaattgaagcggctggcggcgttgccaaagagttcaacaccattgcggtggat
gatgggattgccatgggccacggggggatgctttattcactgccatctcgcgaactgatc
gctgattccgttgagtatatggtcaacgcccactgcgccgacgccatggtctgcatctct
aactgcgacaaaatcaccccggggatgctgatggcttccctgcgcctgaatattccggtg
atctttgtttccggcggcccgatggaggccgggaaaaccaaactttccgatcagatcatc
aagctcgatctggttgatgcgatgatccagggcgcagacccgaaagtatctgactcccag
agcgatcaggttgaacgttccgcgtgtccgacctgcggttcctgctccgggatgtttacc
gctaactcaatgaactgcctgaccgaagcgctgggcctgtcgcagccgggcaacggctcg
ctgctggcaacccacgccgaccgtaagcagctgttccttaatgctggtaaacgcattgtt
gaattgaccaaacgttattacgagcaaaacgacgaaagtgcactgccgcgtaatatcgcc
agtaaggcggcgtttgaaaacgccatgacgctggatatcgcgatgggtggatcgactaac
accgtacttcacctgctggcggcggcgcaggaagcggaaatcgacttcaccatgagtgat
atcgataagctttcccgcaaggttccacagctgtgtaaagttgcgccgagcacccagaaa
taccatatggaagatgttcaccgtgctggtggtgttatcggtattctcggcgaactggat
cgcgcggggttactgaaccgtgatgtgaaaaacgtacttggcctgacgttgccgcaaacg
ctggaacaatacgacgttatgctgacccaggatgacgcggtaaaaaatatgttccgcgca
ggtcctgcaggcattcgtaccacacaggcattctcgcaagattgccgttgggatacgctg
gacgacgatcgcgccaatggctgtatccgctcgctggaacacgcctacagcaaagacggc
ggcctggcggtgctctacggtaactttgcggaaaacggctgcatcgtgaaaacggcaggc
gtcgatgacagcatcctcaaattcaccggcccggcgaaagtgtacgaaagccaggacgat
gcggtagaagcgattctcggcggtaaagttgtcgccggagatgtggtagtaattcgctat
gaaggcccgaaaggcggtccggggatgcaggaaatgctctacccaaccagcttcctgaaa
tcaatgggtctcggcaaagcctgtgcgctgatcaccgacggtcgtttctctggtggcacc
tctggtctttccatcggccacgtctcaccggaagcggcaagcggcggcagcattggcctg
attgaagatggtgacctgatcgctatcgacatcccgaaccgtggcattcagttacaggta
agcgatgccgaactggcggcgcgtcgtgaagcgcaggacgctcgaggtgacaaagcctgg
acgccgaaaaatcgtgaacgtcaggtctcctttgccctgcgtgcttatgccagcctggca
accagcgccgacaaaggcgcggtgcgcgataaatcgaaactggggggttaa
              
                            

Download fasta file
RegulonDB