RegulonDB RegulonDB 10.10: Gene Sequence
ilvE gene sequence


Size: 930        A: 210  T: 209  G: 272  C: 239

Fasta

 

>ilvE E. coli K12. Version NC_000913.3 GI:556503834
atgaccacgaagaaagctgattacatttggttcaatggggagatggttcgctgggaagac
gcgaaggtgcatgtgatgtcgcacgcgctgcactatggcacttcggtttttgaaggcatc
cgttgctacgactcgcacaaaggaccggttgtattccgccatcgtgagcatatgcagcgt
ctgcatgactccgccaaaatctatcgcttcccggtttcgcagagcattgatgagctgatg
gaagcttgtcgtgacgtgatccgcaaaaacaatctcaccagcgcctatatccgtccgctg
atcttcgtcggtgatgttggcatgggagtaaacccgccagcgggatactcaaccgacgtg
attatcgctgctttcccgtggggagcgtatctgggcgcagaagcgctggagcaggggatc
gatgcgatggtttcctcctggaaccgcgcagcaccaaacaccatcccgacggcggcaaaa
gccggtggtaactacctctcttccctgctggtgggtagcgaagcgcgccgccacggttat
caggaaggtatcgcgctggatgtgaacggttatatctctgaaggcgcaggcgaaaacctg
tttgaagtgaaagatggtgtgctgttcaccccaccgttcacctcctccgcgctgccgggt
attacccgtgatgccatcatcaaactggcgaaagagctgggaattgaagtacgtgagcag
gtgctgtcgcgcgaatccctgtacctggcggatgaagtgtttatgtccggtacggcggca
gaaatcacgccagtgcgcagcgtagacggtattcaggttggcgaaggccgttgtggcccg
gttaccaaacgcattcagcaagccttcttcggcctcttcactggcgaaaccgaagataaa
tggggctggttagatcaagttaatcaataa
              
                            

Download fasta file
RegulonDB