RegulonDB RegulonDB 10.9: Gene Sequence
ilvM gene sequence


Size: 264        A: 71  T: 63  G: 58  C: 72

Fasta

 

>ilvM E. coli K12. Version NC_000913.3 GI:556503834
atgatgcaacatcaggtcaatgtatcggctcgcttcaatccagaaaccttagaacgtgtt
ttacgcgtggtgcgtcatcgtggtttccacgtctgctcaatgaatatggccgccgccagc
gatgcacaaaatataaatatcgaattgaccgttgccagcccacggtcggtcgacttactg
tttagtcagttaaataaactggtggacgtcgcacacgttgccatctgccagagcacaacc
acatcacaacaaatccgcgcctga
              
                            

Download fasta file
RegulonDB