RegulonDB RegulonDB 10.9: Gene Sequence
kdsB gene sequence


Size: 747        A: 165  T: 188  G: 211  C: 183

Fasta

 

>kdsB E. coli K12. Version NC_000913.3 GI:556503834
atgagttttgtggtcattattcccgcgcgctacgcgtccacgcgtctgcccggtaaacca
ttggttgatattaacggcaaacccatgattgttcatgttcttgaacgcgcgcgtgaatca
ggtgccgagcgcatcatcgtggcaaccgatcatgaggatgttgcccgcgccgttgaagcc
gctggcggtgaagtatgtatgacgcgcgccgatcatcagtcaggaacagaacgtctggcg
gaagttgtcgaaaaatgcgcattcagcgacgacacggtgatcgttaatgtgcagggtgat
gaaccgatgatccctgcgacaatcattcgtcaggttgctgataacctcgctcagcgtcag
gtgggtatggcgactctggcggtgccaatccacaatgcggaagaagcgtttaacccgaat
gcggtgaaagtggttctcgacgctgaagggtatgcactgtacttctctcgcgccaccatt
ccttgggatcgtgatcgttttgcagaaggccttgaaaccgttggcgataacttcctgcgt
catcttggtatttatggctaccgtgcaggctttatccgtcgttacgtcaactggcagcca
agtccgttagaacacatcgaaatgttagagcagcttcgtgttctgtggtacggcgaaaaa
atccatgttgctgttgctcaggaagttcctggcacaggtgtggatacccctgaagatctt
gagcgcgttcgcgctgaaatgcgctaa
              
                            

Download fasta file
RegulonDB