RegulonDB RegulonDB 10.9: Gene Sequence
waaA gene sequence


Size: 1278        A: 274  T: 315  G: 334  C: 355

Fasta

 

>waaA E. coli K12. Version NC_000913.3 GI:556503834
atgctcgaattgctttacaccgcccttctctaccttattcagccgctgatctggatacgg
ctctgggtgcgcggacgtaaggctccggcctatcgaaaacgctggggtgaacgttacggt
ttttaccgccatccgctaaaaccaggcggcattatgctgcactccgtctccgtcggtgaa
actctggcggcaatcccgttggtgcgcgcgctgcgtcatcgttatcctgatttaccgatt
accgtaacaaccatgacgccaaccggttcggagcgcgtacaatcggctttcgggaaggat
gttcagcacgtttatctgccgtatgatctgcccgatgcactcaaccgtttcctgaataaa
gtcgaccctaaactggtgttgattatggaaaccgaactatggcctaacctgattgcggcg
ctacataaacgtaaaattccgctggtgatcgctaacgcgcgactctctgcccgctcggcc
gcaggttatgccaaactgggtaaattcgtccgtcgcttgctgcgtcgtattacgctgatt
gctgcgcaaaatgaagaagatggtgcacgttttgtggcgctgggcgcaaaaaataatcag
gtgaccgttaccggtagcctgaaattcgatatttctgtaacgccgcagttggctgctaaa
gccgtgacgctgcgccgccagtgggcaccacaccgcccggtatggattgccaccagcact
cacgaaggcgaagagagtgtggtgatcgccgcacatcaggcattgttacagcaattcccg
aatttattgctcatcctggtaccccgtcatccggaacgcttcccggatgcgattaacctt
gtccgccaggctggactaagctatatcacacgctcttcaggggaagtcccctccaccagc
acgcaggttgtggttggcgatacgatgggcgagttgatgttactgtatggcattgccgat
ctcgcctttgttggcggttcactggttgaacgtggtgggcataatccgctggaagctgcc
gcacacgctattccggtattgatggggccgcatacttttaactttaaagacatttgcgcg
cggctggagcaggcaagcgggctgattaccgttaccgatgccactacgcttgcaaaagag
gtttcctctttactcaccgacgccgattaccgtagtttctatggccgtcatgccgttgaa
gtactgtatcaaaaccagggcgcgctacagcgtctgcttcaactgctggaaccttacctg
ccaccgaaaacgcattga
              
                            

Download fasta file
RegulonDB