RegulonDB RegulonDB 10.8: Gene Sequence
kefC gene sequence


Size: 1863        A: 367  T: 462  G: 593  C: 441

Fasta

 

>kefC E. coli K12. Version NC_000913.3 GI:556503834
atggatagccatacgctgattcaggcgctgatttatctcggttcggcagcgctgattgta
cccattgcggtacgtcttggtctgggatcggtacttggctacctgatcgccggctgcatt
attggcccgtgggggctgcgactggtgaccgatgccgaatctattctgcactttgccgag
attggggtggtgctgatgctgtttattatcggcctcgaactcgatccacaaaggctgtgg
aagctgcgtgcggcagtgttcggctgtggcgcattgcagatggtgatttgcggcggcctg
ctggggctgttctgcatgttacttgggctgcgctggcaggtcgcggaattgatcggcatg
acgctggcgctctcctctacggcgattgccatgcaggcgatgaatgaacgcaatctgatg
gtgacgcaaatgggtcgcagtgcctttgcggtgctgctgttccaggatatcgcggcgatc
ccgctggtggcgatgattccgctactggcaacgagcagtgcctcgacgacgatgggcgca
tttgctctctcggcgttaaaagtggcgggtgcgctggtgctggtggtattgctggggcgc
tatgtcacgcgtccggcgctgcgttttgtagcccgctctggcttgcgggaagtgtttagt
gccgtggcgttattcctcgtgtttggctttggtttgctgctggaagaggtcggcttgtcg
atggcgatgggcgcgtttctggcgggcgtactgctggcaagctcggaataccgtcatgcg
ctggagagcgatatcgaaccatttaaaggtttgctgttggggctgtttttcatcggtgtt
ggcatgtcgatagactttggcacgctgcttgaaaacccattgcgcattgtcattttgctg
ctcggtttcctcatcatcaaaatcgccatgctgtggctgattgcccgaccgttgcaagtg
ccaaataaacagcgtcgttggtttgcggtgttgttagggcagggcagtgagtttgccttt
gtggtatttggcgcggcgcagatggcgaatgtgctggagccggagtgggcgaaatcgctg
accctggcggtggcgctgtcgatggcagcaacgccgattctgctggtgatcctcaatcgc
cttgagcaatcttctactgaggaagcgcgtgaagccgatgagatcgacgaagaacagccg
cgcgtgattatcgccggattcggtcgttttgggcagattaccggacgtttactgctctcc
agcggggtgaaaatggtggtactcgatcacgatccggaccatatcgaaaccttgcgtaaa
tttggtatgaaagtgttttatggcgatgccacgcggatggatttactggaatctgccgga
gcggcgaaagcggaagtgctgattaacgccatcgacgatccgcaaaccaacctgcaactg
acagagatggtgaaagaacatttcccgcatttgcagattattgcccgcgcccgcgatgtc
gaccactacattcgtttgcgtcaggcaggcgttgaaaagccggagcgtgaaaccttcgaa
ggtgcgctgaaaaccgggcgtctggcactggaaagtttaggtctggggccgtatgaagcg
cgagaacgtgccgatgtgttccgccgctttaatattcagatggtggaagagatggcaatg
gttgagaacgacaccaaagcccgcgcggcggtctataaacgcaccagcgcgatgttaagt
gagatcattaccgaggaccgcgaacatctgtcattaattcaacgacatggctggcaggga
accgaagaaggtaaacataccggcaacatggcggatgaaccggaaacgaaaccctcatcc
taa
              
                            

Download fasta file
RegulonDB