RegulonDB RegulonDB 10.8: Gene Sequence
rsmA gene sequence


Size: 822        A: 197  T: 189  G: 216  C: 220

Fasta

 

>rsmA E. coli K12. Version NC_000913.3 GI:556503834
atgaataatcgagtccaccagggccacttagcccgtaaacgcttcgggcaaaactttctc
aacgatcagttcgtgatcgacagtattgtgtctgccattaacccgcaaaagggccaggcg
atggtcgaaatcggccccggtctggcggcattgaccgaaccggtcggcgaacgtctggac
cagctgacggtcatcgaacttgaccgcgatctggcggcacgtctgcaaacgcatccattc
ttaggcccgaaactgacgatttatcagcaggatgcgatgacctttaactttggtgaactg
gccgagaaaatgggtcagccgctgcgtgttttcggcaacctgccttataacatctccacg
ccgttgatgttccatctgtttagctatactgatgccattgccgacatgcactttatgttg
caaaaagaggtggtgaatcgtctggttgcaggaccgaacagcaaagcgtatggtcgatta
agcgtcatggcgcaatactattgcaatgtgatcccggtactggaagtaccgccgtcagcc
tttacaccaccacccaaagtggattccgccgtcgtgcgcctggttcctcatgcaacgatg
cctcacccggttaaagatgttcgtgtgttgagccgcatcaccaccgaagcctttaaccag
cgtcgtaaaaccattcgtaacagcctcggcaacctgtttagcgtcgaggtgttaacggga
atggggatcgacccggcgatgcgagcggaaaatatctctgtcgcgcaatattgccagatg
gcgaactatctggcggagaacgcgcctttgcaggagagttaa
              
                            

Download fasta file
RegulonDB