RegulonDB RegulonDB 11.0: Gene Sequence
lamB gene sequence


Size: 1341        A: 336  T: 312  G: 360  C: 333

Fasta

 

>lamB E. coli K12. Version NC_000913.3 GI:556503834
atgatgattactctgcgcaaacttcctctggcggttgccgtcgcagcgggcgtaatgtct
gctcaggcaatggctgttgatttccacggctatgcacgttccggtattggttggacaggt
agcggcggtgaacaacagtgtttccagactaccggtgctcaaagtaaataccgtcttggc
aacgaatgtgaaacttatgctgaattaaaattgggtcaggaagtgtggaaagagggcgat
aagagcttctatttcgacactaacgtggcctattccgtcgcacaacagaatgactgggaa
gctaccgatccggccttccgtgaagcaaacgtgcagggtaaaaacctgatcgaatggctg
ccaggctccaccatctgggcaggtaagcgcttctaccaacgtcatgacgttcatatgatc
gacttctactactgggatatttctggtcctggtgccggtctggaaaacatcgatgttggc
ttcggtaaactctctctggcagcaacccgctcctctgaagctggtggttcttcctctttc
gccagcaacaatatttatgactataccaacgaaaccgcgaacgacgttttcgatgtgcgt
ttagcgcagatggaaatcaacccgggcggcacattagaactgggtgtcgactacggtcgt
gccaacttgcgtgataactatcgtctggttgatggcgcatcgaaagacggctggttattc
actgctgaacatactcagagtgtcctgaagggctttaacaagtttgttgttcagtacgct
actgactcgatgacctcgcagggtaaagggctgtcgcagggttctggcgttgcatttgat
aacgaaaaatttgcctacaatatcaacaacaacggtcacatgctgcgtatcctcgaccac
ggtgcgatctccatgggcgacaactgggacatgatgtacgtgggtatgtaccaggatatc
aactgggataacgacaacggcaccaagtggtggaccgtcggtattcgcccgatgtacaag
tggacgccaatcatgagcaccgtgatggaaatcggctacgacaacgtcgaatcccagcgc
accggcgacaagaacaatcagtacaaaattaccctcgcacaacaatggcaggctggcgac
agcatctggtcacgcccggctattcgtgtcttcgcaacctacgccaagtgggatgagaaa
tggggttacgactacaccggtaacgctgataacaacgcgaacttcggcaaagccgttcct
gctgatttcaacggcggcagcttcggtcgtggcgacagcgacgagtggaccttcggtgcc
cagatggaaatctggtggtaa
              
                            

Download fasta file
RegulonDB