RegulonDB RegulonDB 10.8: Gene Sequence
lepA gene sequence


Size: 1800        A: 446  T: 387  G: 498  C: 469

Fasta

 

>lepA E. coli K12. Version NC_000913.3 GI:556503834
atgaagaatatacgtaacttttcgatcatagctcacattgaccacggtaaatcgacgctg
tctgaccgtattatccagatctgcggtggcctgtctgaccgtgaaatggaggcgcaggtt
ctcgattccatggatcttgagcgtgagcgtggcattaccatcaaagcgcaaagcgtgacg
ctggactacaaagcgtctgacggcgaaacctatcagcttaactttatcgacaccccgggc
cacgtagacttctcctatgaagtttcccgttcgctggctgcctgtgaaggtgcattgctg
gtggtcgacgccgggcagggcgtagaagcgcaaaccctggcaaactgctacaccgccatg
gaaatggatctcgaagttgtgccggtactgaacaagattgacctgccggcagccgatcct
gaacgcgtggcggaagaaattgaagatatcgtcggcatcgacgccaccgacgcggtgcgc
tgttcagcgaaaaccggcgttggtgtgcaggacgttctcgaacgtctggtgcgcgacatt
ccgccgccggaaggcgatccggaaggcccgttgcaggcactaattatcgactcatggttc
gacaactacctgggcgttgtttcacttatccgtattaaaaacggcaccctgcgtaagggc
gacaaagtgaaagtcatgagtaccgggcagacctataacgccgaccgtctgggcatcttc
acgccgaaacaggttgaccgcactgaactgaaatgtggcgaagtaggctggctcgtatgt
gcgattaaagatatccacggcgctccagtcggcgataccttaacgctggcgcgtaatccg
gcagaaaaggcgctgcctggctttaagaaagtcaaaccgcaggtatacgccggtctgttc
ccggtaagttccgacgactatgaagccttccgtgacgcgctgggtaaactcagcctgaac
gatgcctcactgttctatgagccggaaagctccagcgcgctgggctttggtttccgctgc
ggcttcctcggcctgctgcacatggagatcatccaggaacgtctggaacgtgaatacgat
ctggatctgatcaccactgcgccgaccgtagtgtatgaagttgaaaccacgtcaagagaa
gttatctacgtcgacagcccatccaagctgcctgcggtaaataacatctacgaactgcgc
gagccgattgcagagtgtcacatgctgctgccgcaggcatatctcggcaacgttattacg
ttgtgcgtagaaaaacgcggcgtgcagaccaatatggtttaccacggtaatcaggtggcg
ctgacgtacgagatcccgatggcggaagtggtgctcgacttcttcgatcgcctgaaatct
acctcgcgtggttatgcgtctctggattacaacttcaagcgcttccaggcgtccgacatg
gtacgtgtagacgtattaatcaacggtgaacgtgttgatgcgctggcgttgatcacccac
cgtgataattcgcaaaaccgcggtcgcgagttggtggagaagatgaaagatctgatccca
cgccagcagtttgatatcgccattcaggcagcgattggtacgcacatcattgcgcgatcc
accgtgaaacagctgcgtaaaaacgtactggctaaatgttatggcggcgatatcagccgt
aagaaaaagctgctgcagaagcagaaagaaggtaagaaacgcatgaagcagatcggtaac
gtcgagctgccgcaggaagcgttcctcgccattctgcacgtcggcaaagacaacaaataa
              
                            

Download fasta file
RegulonDB