RegulonDB RegulonDB 10.8: Gene Sequence
lepB gene sequence


Size: 975        A: 236  T: 232  G: 280  C: 227

Fasta

 

>lepB E. coli K12. Version NC_000913.3 GI:556503834
atggcgaatatgtttgccctgattctggtgattgccacactggtgacgggcattttatgg
tgcgtggataaattctttttcgcacctaaacggcgggaacgtcaggcagcggcgcaggcg
gctgccggggactcactggataaagcaacgttgaaaaaggttgcgccgaagcctggctgg
ctggaaaccggtgcttctgtttttccggtactggctatcgtattgattgtgcgttcgttt
atttatgaaccgttccagatcccgtcaggttcgatgatgccgactctgttaattggtgat
tttattctggtagagaagtttgcttatggcattaaagatcctatctaccagaaaacgctg
atcgaaaccggtcatccgaaacgcggcgatatcgtggtctttaaatatccggaagatcca
aagcttgattacatcaagcgcgcggtgggtttaccgggcgataaagtcacttacgatccg
gtctcaaaagagctgacgattcaaccgggatgcagttccggccaggcgtgtgaaaacgcg
ctgccggtcacctactcaaacgtggaaccgagcgatttcgttcagaccttctcacgccgt
aatggtggggaagcgaccagcggattctttgaagtgccgaaaaacgaaaccaaagaaaat
ggaattcgtctttccgagcgtaaagagacactgggtgatgtgacgcaccgcattctgaca
gtgccgattgcgcaggatcaggtggggatgtattaccagcagccagggcaacaactggca
acctggattgttcctccgggacaatacttcatgatgggcgacaaccgcgacaacagcgcg
gacagccgttactggggctttgtgccggaagcgaatctggtcggtcgggcaacggctatc
tggatgagcttcgataagcaagaaggcgaatggccgactggtctgcgcttaagtcgcatt
ggcggcatccattaa
              
                            

Download fasta file
RegulonDB