RegulonDB RegulonDB 10.9: Gene Sequence
lon gene sequence


Size: 2355        A: 611  T: 512  G: 678  C: 554

Fasta

 

>lon E. coli K12. Version NC_000913.3 GI:556503834
atgaatcctgagcgttctgaacgcattgaaatccccgtattgccgctgcgcgatgtggtg
gtttatccgcacatggtcatccccttatttgtcgggcgggaaaaatctatccgttgtctg
gaagcggcgatggaccatgataaaaaaattatgctggtcgcgcagaaagaagcttcaacg
gatgagccgggtgtaaacgatcttttcaccgtcgggaccgtggcctctatattgcagatg
ctgaaactgcctgacggcaccgtcaaagtgctggtcgaggggttacagcgcgcgcgtatt
tctgcgctctctgacaatggcgaacacttttctgcgaaggcggagtatctggagtcgccg
accattgatgagcgggaacaggaagtgctggtgcgtactgcaatcagccagttcgaaggc
tacatcaagctgaacaaaaaaatcccaccagaagtgctgacgtcgctgaatagcatcgac
gatccggcgcgtctggcggataccattgctgcacatatgccgctgaaactggctgacaaa
cagtctgttctggagatgtccgacgttaacgaacgtctggaatatctgatggcaatgatg
gaatcggaaatcgatctgctgcaggttgagaaacgcattcgcaaccgcgttaaaaagcag
atggagaaatcccagcgtgagtactatctgaacgagcaaatgaaagctattcagaaagaa
ctcggtgaaatggacgacgcgccggacgaaaacgaagccctgaagcgcaaaatcgacgcg
gcgaagatgccgaaagaggcaaaagagaaagcggaagcagagttgcagaagctgaaaatg
atgtctccgatgtcggcagaagcgaccgtagtgcgtggttatatcgactggatggtacag
gtgccgtggaatgcgcgtagcaaggtcaaaaaagacctgcgtcaggcgcaggaaatcctt
gataccgaccattatggtctggagcgcgtgaaagatcgaatccttgagtatcttgcggtt
caaagccgtgtcaacaaaatcaagggaccgatcctctgcctggtagggccgccgggggta
ggtaaaacctctcttggtcagtccattgccaaagccaccgggcgtaaatatgtccgtatg
gcgctgggcggcgtgcgtgatgaagcggaaatccgtggtcaccgccgtacttacatcggt
tctatgccgggtaaactgatccagaaaatggcgaaagtgggcgtgaaaaacccgctgttc
ctgctcgatgagatcgacaaaatgtcttctgacatgcgtggcgatccggcctctgcactg
cttgaagtgctggatccagagcagaacgtagcgttcagcgaccactacctggaagtggat
tacgatctcagcgacgtgatgtttgtcgcgacgtcgaactccatgaacattccggcaccg
ctgctggatcgtatggaagtgattcgcctctccggttataccgaagatgaaaaactgaac
atcgccaaacgtcacctgctgccgaagcagattgaacgtaatgcactgaaaaaaggtgag
ctgaccgtcgacgatagcgccattatcggcattattcgttactacacccgtgaggcgggc
gtgcgtggtctggagcgtgaaatctccaaactgtgtcgcaaagcggttaagcagttactg
ctcgataagtcattaaaacatatcgaaattaacggcgataacctgcatgactatctcggt
gttcagcgtttcgactatggtcgcgcggataacgaaaaccgtgtcggtcaggtaaccggt
ctggcgtggacggaagtgggcggtgacttgctgaccattgaaaccgcatgtgttccgggt
aaaggcaaactgacctataccggttcgctcggcgaagtgatgcaggagtccattcaggcg
gcgttaacggtggttcgtgcgcgtgcggaaaaactggggatcaaccctgatttttacgaa
aaacgtgacatccacgtccacgtaccggaaggtgcgacgccgaaagatggtccgagtgcc
ggtattgctatgtgcaccgcgctggtttcttgcctgaccggtaacccggttcgtgccgat
gtggcaatgaccggtgagatcactctgcgtggtcaggtactgccgatcggtggtttgaaa
gaaaaactcctggcagcgcatcgcggcgggattaaaacagtgctaattccgttcgaaaat
aaacgcgatctggaagagattcctgacaacgtaattgccgatctggacattcatcctgtg
aagcgcattgaggaagttctgactctggcgctgcaaaatgaaccgtctggtatgcaggtt
gtgactgcaaaatag
              
                            

Download fasta file
RegulonDB