RegulonDB RegulonDB 10.10: Gene Sequence
lpd gene sequence


Size: 1425        A: 373  T: 296  G: 398  C: 358

Fasta

 

>lpd E. coli K12. Version NC_000913.3 GI:556503834
atgagtactgaaatcaaaactcaggtcgtggtacttggggcaggccccgcaggttactcc
gctgccttccgttgcgctgatttaggtctggaaaccgtaatcgtagaacgttacaacacc
cttggcggtgtttgcctgaacgtcggctgtatcccttctaaagcactgctgcacgtagca
aaagttatcgaagaagccaaagcgctggctgaacacggtatcgtcttcggcgaaccgaaa
accgatatcgacaagattcgtacctggaaagagaaagtgatcaatcagctgaccggtggt
ctggctggtatggcgaaaggccgcaaagtcaaagtggtcaacggtctgggtaaattcacc
ggggctaacaccctggaagttgaaggtgagaacggcaaaaccgtgatcaacttcgacaac
gcgatcattgcagcgggttctcgcccgatccaactgccgtttattccgcatgaagatccg
cgtatctgggactccactgacgcgctggaactgaaagaagtaccagaacgcctgctggta
atgggtggcggtatcatcggtctggaaatgggcaccgtttaccacgcgctgggttcacag
attgacgtggttgaaatgttcgaccaggttatcccggcagctgacaaagacatcgttaaa
gtcttcaccaagcgtatcagcaagaaattcaacctgatgctggaaaccaaagttaccgcc
gttgaagcgaaagaagacggcatttatgtgacgatggaaggcaaaaaagcacccgctgaa
ccgcagcgttacgacgccgtgctggtagcgattggtcgtgtgccgaacggtaaaaacctc
gacgcaggcaaagcaggcgtggaagttgacgaccgtggtttcatccgcgttgacaaacag
ctgcgtaccaacgtaccgcacatctttgctatcggcgatatcgtcggtcaaccgatgctg
gcacacaaaggtgttcacgaaggtcacgttgccgctgaagttatcgccggtaagaaacac
tacttcgatccgaaagttatcccgtccatcgcctataccgaaccagaagttgcatgggtg
ggtctgactgagaaagaagcgaaagagaaaggcatcagctatgaaaccgccaccttcccg
tgggctgcttctggtcgtgctatcgcttccgactgcgcagacggtatgaccaagctgatt
ttcgacaaagaatctcaccgtgtgatcggtggtgcgattgtcggtactaacggcggcgag
ctgctgggtgaaatcggcctggcaatcgaaatgggttgtgatgctgaagacatcgcactg
accatccacgcgcacccgactctgcacgagtctgtgggcctggcggcagaagtgttcgaa
ggtagcattaccgacctgccgaacccgaaagcgaagaagaagtaa
              
                            

Download fasta file
RegulonDB