RegulonDB RegulonDB 10.8: Gene Sequence
lspA gene sequence


Size: 495        A: 92  T: 138  G: 141  C: 124

Fasta

 

>lspA E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaatcgatctgttcaacagggctacgctggctgtggctggtggtagtcgtgctg
attatcgatctgggcagcaaatacctgatcctccagaactttgctctgggggatacggtc
ccgctgttcccgtcgcttaatctgcattatgcgcgtaactatggcgcggcgtttagtttc
cttgccgatagcggcggctggcagcgttggttctttgccggtattgcgattggtattagc
gtgatcctggcagtgatgatgtatcgctcgaaggccacgcagaagctaaacaatatcgct
tacgcgctgattattggcggcgcgctgggcaacctgttcgaccgcctgtggcacggcttc
gttgtcgatatgatcgacttctacgtcggcgactggcacttcgccaccttcaaccttgcc
gatactgccatctgtgtcggtgcggcactgattgtgctggaaggttttttgccttctaga
gcgaaaaaacaataa
              
                            

Download fasta file
RegulonDB