RegulonDB RegulonDB 10.9: Gene Sequence
malE gene sequence


Size: 1191        A: 339  T: 244  G: 312  C: 296

Fasta

 

>malE E. coli K12. Version NC_000913.3 GI:556503834
atgaaaataaaaacaggtgcacgcatcctcgcattatccgcattaacgacgatgatgttt
tccgcctcggctctcgccaaaatcgaagaaggtaaactggtaatctggattaacggcgat
aaaggctataacggtctcgctgaagtcggtaagaaattcgagaaagataccggaattaaa
gtcaccgttgagcatccggataaactggaagagaaattcccacaggttgcggcaactggc
gatggccctgacattatcttctgggcacacgaccgctttggtggctacgctcaatctggc
ctgttggctgaaatcaccccggacaaagcgttccaggacaagctgtatccgtttacctgg
gatgccgtacgttacaacggcaagctgattgcttacccgatcgctgttgaagcgttatcg
ctgatttataacaaagatctgctgccgaacccgccaaaaacctgggaagagatcccggcg
ctggataaagaactgaaagcgaaaggtaagagcgcgctgatgttcaacctgcaagaaccg
tacttcacctggccgctgattgctgctgacgggggttatgcgttcaagtatgaaaacggc
aagtacgacattaaagacgtgggcgtggataacgctggcgcgaaagcgggtctgaccttc
ctggttgacctgattaaaaacaaacacatgaatgcagacaccgattactccatcgcagaa
gctgcctttaataaaggcgaaacagcgatgaccatcaacggcccgtgggcatggtccaac
atcgacaccagcaaagtgaattatggtgtaacggtactgccgaccttcaagggtcaacca
tccaaaccgttcgttggcgtgctgagcgcaggtattaacgccgccagtccgaacaaagag
ctggcgaaagagttcctcgaaaactatctgctgactgatgaaggtctggaagcggttaat
aaagacaaaccgctgggtgccgtagcgctgaagtcttacgaggaagagttggcgaaagat
ccacgtattgccgccaccatggaaaacgcccagaaaggtgaaatcatgccgaacatcccg
cagatgtccgctttctggtatgccgtgcgtactgcggtgatcaacgccgccagcggtcgt
cagactgtcgatgaagccctgaaagacgcgcagactcgtatcaccaagtaa
              
                            

Download fasta file
RegulonDB