RegulonDB RegulonDB 10.6.3: Gene Sequence
malF gene sequence


Size: 1545        A: 343  T: 379  G: 410  C: 413

Fasta

 

>malF E. coli K12. Version NC_000913.3 GI:556503834
atggatgtcattaaaaagaaacattggtggcaaagcgacgcgctgaaatggtcagtgcta
ggtctgctcggcctgctggtgggttaccttgttgttttaatgtacgcacaaggggaatac
ctgttcgccattaccacgctgatattgagttcagcggggctgtatattttcgccaatcgt
aaagcctacgcctggcgctatgtttacccgggaatggctggaatgggattattcgtcctc
ttccctctggtctgcaccatcgccattgccttcaccaactacagcagcactaaccagctg
acttttgaacgtgcgcaggaagtgttgttagatcgctcctggcaagcaggcaaaacctat
aactttggtctttacccggcgggcgatgagtggcaactggcgctcagcgacggcgaaacc
ggcaaaaattacctctccgacgcttttaaatttggcggcgagcaaaaactgcaactgaaa
gaaacgaccgcccagcccgaaggcgaacgcgcgaatctgcgcgtgattacccagaatcgt
caggcgctgagtgacattaccgccattctgccggatggcaacaaagtgatgatgagctcc
ctgcgccagttttctggcacgcagccgctctacacactcgacggtgacggcacgttgacg
aataatcagagcggcgtgaaatatcgtccgaataaccaaattggcttttaccagtccatt
accgccgacggcaactggggtgatgaaaagctaagccccggttacaccgtgaccaccggc
tggaaaaactttacccgcgtctttaccgacgaaggcattcagaaaccgttcctcgccatt
ttcgtctggaccgtggtgttctcgctgatcactgtctttttaacggtggcggtcggcatg
gttctggcgtgtctggtgcagtgggaagcgttgcgcggcaaagcggtctatcgcgtcctg
ctgattctgccctacgcggtgccatcgttcatttcaatcttgattttcaaagggttgttt
aaccagagcttcggtgaaatcaacatgatgttgagcgcgctgtttggcgtgaagcccgcc
tggttcagcgatccgaccaccgcccgcacgatgctaattatcgtcaatacctggctgggt
tatccgtacatgatgatcctctgcatgggcttgctgaaagcgattccggacgatttgtat
gaagcctcagcaatggatggcgcaggtccgttccagaacttctttaagattacgctgccg
ctgctgattaaaccgctgacgccgctgatgatcgccagcttcgcctttaactttaacaac
ttcgtgctgattcaactgttaaccaacggcggcccggatcgtcttggcacgaccacgcca
gccggttataccgacctgcttgttaactacacctaccgcatcgcttttgaaggcggcggg
ggtcaggacttcggtctggcggcagcaattgccacgctgatcttcctgctggtgggtgcg
ctggcgatagtgaacctgaaagccacgcgaatgaagtttgattaa
              
                            

Download fasta file
RegulonDB