RegulonDB RegulonDB 10.10: Gene Sequence
malK gene sequence


Size: 1116        A: 257  T: 247  G: 322  C: 290

Fasta

 

>malK E. coli K12. Version NC_000913.3 GI:556503834
atggcgagcgtacagctgcaaaatgtaacgaaagcctggggcgaggtcgtggtatcgaaa
gatatcaatctcgatatccatgaaggtgaattcgtggtgtttgtcggaccgtctggctgc
ggtaaatcgactttactgcgcatgattgccgggcttgagacgatcaccagcggcgacctg
ttcatcggtgagaaacggatgaatgacactccgccagcagaacgcggcgttggtatggtg
tttcagtcttacgcgctctatccccacctgtcagtagcagaaaacatgtcatttggcctg
aaactggctggcgcaaaaaaagaggtgattaaccaacgcgttaaccaggtggcggaagtg
ctacaactggcgcatttgctggatcgcaaaccgaaagcgctctccggtggtcagcgtcag
cgtgtggcgattggccgtacgctggtggccgagccaagcgtatttttgctcgatgaaccg
ctctccaacctcgatgctgcactgcgtgtgcaaatgcgtatcgaaatctcccgtctgcat
aaacgcctgggccgcacaatgatttacgtcacccacgatcaggtcgaagcgatgacgctg
gccgacaaaatcgtggtgctggacgccggtcgcgtggcgcaggttgggaaaccgctggag
ctgtaccactatccggcagaccgttttgtcgccggatttatcggttcgccaaagatgaac
ttcctgccggtaaaagtgaccgccaccgcaatcgatcaagtgcaggtggagctgccgatg
ccaaatcgtcagcaagtctggctgccagttgaaagccgtgatgtccaggttggagccaat
atgtcgctgggtattcgcccggaacatctactgccgagtgatatcgctgacgtcatcctt
gagggtgaagttcaggtcgtcgagcaactcggcaacgaaactcaaatccatatccagatc
ccttccattcgtcaaaacctggtgtaccgccagaacgacgtggtgttggtagaagaaggt
gccacattcgctatcggcctgccgccagagcgttgccatctgttccgtgaggatggcact
gcatgtcgtcgactgcataaggagccgggcgtttaa
              
                            

Download fasta file
RegulonDB