RegulonDB RegulonDB 11.0: Gene Sequence
malM gene sequence


Size: 921        A: 238  T: 191  G: 228  C: 264

Fasta

 

>malM E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatgaataaaagtctcatcgtcctctgtttatcagcagggttactggcaagcgcg
cctggaattagccttgccgatgttaactacgtaccgcaaaacaccagcgacgcgccagcc
attccatctgctgcgctgcaacaactcacctggacaccggtcgatcaatctaaaacccag
accacccaactggcgaccggcggccaacaactgaacgttcccggcatcagtggtccggtt
gctgcgtacagcgtcccggcaaacattggcgaactgaccctgacgctgaccagcgaagtg
aacaaacaaaccagcgtttttgcgccgaacgtgctgattcttgatcagaacatgacccca
tcagccttcttccccagcagttatttcacctaccaggaaccaggcgtgatgagtgcagat
cggctggaaggcgttatgcgcctgacaccggcgttggggcagcaaaaactttatgttctg
gtctttaccacggaaaaagatctccagcagacgacccaactgctcgacccggctaaagcc
tatgccaagggcgtcggtaactcgatcccggatatccccgatccggttgctcgtcatacc
accgatggcttactgaaactgaaagtgaaaacgaactccagctccagcgtgttggtagga
cctttatttggttcttccgctccagctccggttacggtaggtaacacggcggcaccagct
gtggctgcacccgctccggcaccggtgaagaaaagcgagccgatgctcaacgacacggaa
agttattttaataccgcgatcaaaaacgctgtcgcgaaaggtgatgttgataaggcgtta
aaactgcttgatgaagctgaacgcctgggatcgacatctgcccgttccacctttatcagc
agtgtaaaaggcaaggggtaa
              
                            

Download fasta file
RegulonDB