RegulonDB RegulonDB 10.9: Gene Sequence
malY gene sequence


Size: 1173        A: 272  T: 303  G: 315  C: 283

Fasta

 

>malY E. coli K12. Version NC_000913.3 GI:556503834
atgttcgatttttcaaaggtcgtggatcgtcatggcacatggtgtacacagtgggattat
gtcgctgaccgtttcggcactgctgacctgttaccgttcacgatttcagacatggatttt
gccactgccccctgcattatcgaggcgctgaatcagcgcctgatgcacggcgtatttggc
tacagccgctggaaaaacgatgagtttctcgcggctattgcccactggttttccacccag
cattacaccgccatcgattctcagacggtggtgtatggcccttctgtcatctatatggtt
tcagaactgattcgtcagtggtctgaaacaggtgaaggcgtggtgatccacacacccgcc
tatgacgcattttacaaggccattgaaggtaaccagcgcacagtaatgcccgttgcttta
gagaagcaggctgatggttggttttgcgatatgggcaagttggaagccgtgttggcgaaa
ccagaatgtaaaattatgctcctgtgtagcccacagaatcctaccgggaaagtgtggacg
tgcgatgagctggagatcatggctgacctgtgcgagcgtcatggtgtgcgggttatttcc
gatgaaatccatatggatatggtttggggcgagcagccgcatattccctggagtaatgtg
gctcgcggagactgggcgttgctaacgtcgggctcgaaaagtttcaatattcccgccctg
accggtgcttacgggattatagaaaatagcagtagccgcgatgcctatttatcggcactg
aaaggccgtgatgggctttcttccccttcggtactggcgttaactgcccatatcgccgcc
tatcagcaaggcgcgccgtggctggatgccttacgcatctatctgaaagataacctgacg
tatatcgcagataaaatgaacgccgcgtttcctgaactcaactggcagatcccacaatcc
acttatctggcatggcttgatttacgtccgttgaatattgacgacaacgcgttgcaaaaa
gcacttatcgaacaagaaaaagtcgcgatcatgccggggtatacctacggtgaagaaggt
cgtggttttgtccgtctcaatgccggctgcccacgttcgaaactggaaaaaggtgtggct
ggattaattaacgccatccgcgctgttcgttaa
              
                            

Download fasta file
RegulonDB