RegulonDB RegulonDB 10.8: Gene Sequence
malZ gene sequence


Size: 1815        A: 408  T: 416  G: 542  C: 449

Fasta

 

>malZ E. coli K12. Version NC_000913.3 GI:556503834
atgttaaatgcatggcacctgccggtgcccccatttgttaaacaaagcaaagatcaactg
ctcattacactgtggctgacgggcgaagacccaccgcagcgcattatgctgcgtacagaa
cacgataacgaagaaatgtcagtaccgatgcataagcagcgcagtcagccgcagcctggc
gtcaccgcatggcgtgcggcgattgatctctccagcggacaaccccggcggcgttacagt
ttcaaactgctgtggcacgatcgccagcgttggtttacaccgcagggcttcagccgaatg
ccgccggcacgactggagcagtttgccgtcgatgtaccggatatcggcccacaatgggct
gcggatcagattttttatcagatcttccctgatcgttttgcgcgtagtcttcctcgtgaa
gctgaacaggatcatgtctattaccatcatgcagccggacaagagatcatcttgcgtgac
tgggatgaaccggtcacggcgcaggcgggcggatcaacgttctatggcggcgatctggac
gggataagcgaaaaactgccgtatctgaaaaagcttggcgtgacagcgctgtatctcaat
ccggtgtttaaagctcccagcgtacataaatacgataccgaggattatcgccatgtcgat
ccgcagtttggcggtgatggggcgttgctgcgtttgcgacacaatacgcagcagctggga
atgcggctggtgctggacggcgtgtttaaccacagtggcgattcccatgcctggtttgac
aggcataatcgtggcacgggtggtgcttgtcacaaccccgaatcgccctggcgcgactgg
tactcgtttagtgatgatggcacggcgctcgactggcttggctatgccagcttgccgaag
ctggattatcagtcggaaagtctggtgaatgaaatttatcgcggggaagacagtattgtc
cgccactggctgaaagcgccgtggaatatggacggctggcggctggatgtggtgcatatg
ctgggggaggcgggtggggcgcgcaataatatgcagcacgttgccgggatcaccgaagcg
gcgaaagaaacccagccggaagcgtatattgtcggcgaacattttggcgatgcacggcaa
tggttacaggccgatgtggaagatgccgccatgaactatcgtggcttcacattcccgttg
tggggatttcttgccaataccgatatctcttacgatccgcagcaaattgatgcccaaacc
tgtatggcctggatggataattaccgcgcagggctttctcatcaacaacaattacgtatg
tttaatcagctcgacagccacgatactgcgcgatttaaaacgctgctcggtcgggatatt
gcgcgcctgccgctggcggtggtctggctgttcacctggcctggtgtaccgtgcatttat
tacggtgatgaagtaggactggatggcaaaaacgatccgttttgccgtaaaccgttcccc
tggcaggtggaaaagcaggatacggcgttattcgcgctgtaccagcgaatgattgcgctg
cgtaagaaaagtcaggcgctacgtcatggcggctgtcaggtgctgtatgcggaagataac
gtggtggtatttgtccgcgtgctgaatcagcaacgtgtactggtggcaatcaaccgtggc
gaggcctgtgaagtggtgctacccgcgtcaccgtttctcaatgccgtgcaatggcaatgc
aaagaagggcatgggcaactgactgacgggattctggctttgcctgccatttcggctacg
gtatggatgaactaa
              
                            

Download fasta file
RegulonDB