RegulonDB RegulonDB 10.8: Gene Sequence
mazE gene sequence


Size: 249        A: 74  T: 54  G: 71  C: 50

Fasta

 

>mazE E. coli K12. Version NC_000913.3 GI:556503834
atgatccacagtagcgtaaagcgttggggaaattcaccggcggtgcggatcccggctacg
ttaatgcaggcgctcaatctgaatattgatgatgaagtgaagattgacctggtggatggc
aaattaattattgagccagtgcgtaaagagcccgtatttacgcttgctgaactggtcaac
gacatcacgccggaaaacctccacgagaatatcgactggggagagccgaaagataaggaa
gtctggtaa
              
                            

Download fasta file
RegulonDB