RegulonDB RegulonDB 10.8: Gene Sequence
mazG gene sequence


Size: 792        A: 210  T: 180  G: 226  C: 176

Fasta

 

>mazG E. coli K12. Version NC_000913.3 GI:556503834
atgaatcaaatcgaccgtttgctcactattatgcagcgcctgcgcgatccggaaaacggc
tgcccgtgggataaagagcagacatttgccaccattgcgccttacacccttgaagaaacc
tacgaagtgctggacgccatcgcccgtgaagattttgacgatcttcgcggtgaactgggc
gatctgctattccaggtggtgttttacgcgcaaatggctcaggaagaagggcgctttgac
tttaatgatatttgcgctgctattagcgataaattagagcgtcgccatccgcatgttttt
gctgatagttctgccgaaaacagtagtgaagtgcttgcccgttgggagcaaatcaaaacc
gaagagcgcgcgcagaaagcgcagcattcggcgctggacgatattcctcgtagtttaccg
gctttaatgcgtgcgcaaaaaatccagaaacgttgcgccaacgttggcttcgattggacg
acgcttggtccggtagtcgataaagtctacgaagagatcgacgaggtgatgtacgaagcg
cggcaggctgttgtcgaccaggctaaactggaggaggaaatgggggacctgctgtttgcc
acggttaatctggctcgccatttagggacgaaagcagaaatcgcattgcaaaaagcgaac
gaaaaattcgagcgtcgttttcgcgaagtggagcgtattgttgccgcgcgtggactggaa
atgacaggtgttgacctcgaaacaatggaagaagtctggcaacaggtaaaacggcaggaa
attgatctctaa
              
                            

Download fasta file
RegulonDB