RegulonDB RegulonDB 10.9: Gene Sequence
metF gene sequence


Size: 891        A: 213  T: 216  G: 250  C: 212

Fasta

 

>metF E. coli K12. Version NC_000913.3 GI:556503834
atgagcttttttcacgccagccagcgggatgccctgaatcagagcctggcagaagtccag
gggcagattaacgtttcgttcgagtttttcccgccgcgtaccagtgaaatggagcagacc
ctgtggaactccatcgatcgccttagcagcctgaaaccgaagtttgtatcggtgacctat
ggcgcgaactccggcgagcgcgaccgtacgcacagcattattaaaggcattaaagatcgc
actggtctggaagcggcaccgcatcttacttgcattgatgcgacgcccgacgagctgcgc
accattgcacgcgactactggaataacggtattcgtcatatcgtggcgctgcgtggcgat
ctgccgccgggaagtggtaagccagaaatgtatgcttctgacctggtgacgctgttaaaa
gaagtggcagatttcgatatctccgtggcggcgtatccggaagttcacccggaagcaaaa
agcgctcaggcggatttgcttaatctgaaacgcaaagtggatgccggagccaaccgcgcg
attactcagttcttcttcgatgtcgaaagctacctgcgttttcgtgaccgctgtgtatcg
gcgggcattgatgtggaaattattccgggaattttgccggtatctaactttaaacaggcg
aagaaatttgccgatatgaccaacgtgcgtattccggcgtggatggcgcaaatgttcgac
ggtctggatgatgatgccgaaacccgcaaactggttggcgcgaatattgccatggatatg
gtgaagattttaagccgtgaaggagtgaaagatttccacttctatacgcttaaccgtgct
gaaatgagttacgcgatttgccatacgctgggggttcgacctggtttataa
              
                            

Download fasta file
RegulonDB