RegulonDB RegulonDB 10.10: Gene Sequence
metK gene sequence


Size: 1155        A: 277  T: 263  G: 303  C: 312

Fasta

 

>metK E. coli K12. Version NC_000913.3 GI:556503834
atggcaaaacacctttttacgtccgagtccgtctctgaagggcatcctgacaaaattgct
gaccaaatttctgatgccgttttagacgcgatcctcgaacaggatccgaaagcacgcgtt
gcttgcgaaacctacgtaaaaaccggcatggttttagttggcggcgaaatcaccaccagc
gcctgggtagacatcgaagagatcacccgtaacaccgttcgcgaaattggctatgtgcat
tccgacatgggctttgacgctaactcctgtgcggttctgagcgctatcggcaaacagtct
cctgacatcaaccagggcgttgaccgtgccgatccgctggaacagggcgcgggtgaccag
ggtctgatgtttggctacgcaactaatgaaaccgacgtgctgatgccagcacctatcacc
tatgcacaccgtctggtacagcgtcaggctgaagtgcgtaaaaacggcactctgccgtgg
ctgcgcccggacgcgaaaagccaggtgacttttcagtatgacgacggcaaaatcgttggt
atcgatgctgtcgtgctttccactcagcactctgaagagatcgaccagaaatcgctgcaa
gaagcggtaatggaagagatcatcaagccaattctgcccgctgaatggctgacttctgcc
accaaattcttcatcaacccgaccggtcgtttcgttatcggtggcccaatgggtgactgc
ggtctgactggtcgtaaaattatcgttgatacctacggcggcatggcgcgtcacggtggc
ggtgcattctctggtaaagatccatcaaaagtggaccgttccgcagcctacgcagcacgt
tatgtcgcgaaaaacatcgttgctgctggcctggccgatcgttgtgaaattcaggtttcc
tacgcaatcggcgtggctgaaccgacctccatcatggtagaaactttcggtactgagaaa
gtgccttctgaacaactgaccctgctggtacgtgagttcttcgacctgcgcccatacggt
ctgattcagatgctggatctgctgcacccgatctacaaagaaaccgcagcatacggtcac
tttggtcgtgaacatttcccgtgggaaaaaaccgacaaagcgcagctgctgcgcgatgct
gccggtctgaagtaa
              
                            

Download fasta file
RegulonDB