RegulonDB RegulonDB 10.9: Gene Sequence
metL gene sequence


Size: 2433        A: 483  T: 531  G: 754  C: 665

Fasta

 

>metL E. coli K12. Version NC_000913.3 GI:556503834
atgagtgtgattgcgcaggcaggggcgaaaggtcgtcagctgcataaatttggtggcagt
agtctggctgatgtgaagtgttatttgcgtgtcgcgggcattatggcggagtactctcag
cctgacgatatgatggtggtttccgccgccggtagcaccactaaccagttgattaactgg
ttgaaactaagccagaccgatcgtctctctgcgcatcaggttcaacaaacgctgcgtcgc
tatcagtgcgatctgattagcggtctgctacccgctgaagaagccgatagcctcattagc
gcttttgtcagcgaccttgagcgcctggcggcgctgctcgacagcggtattaacgacgca
gtgtatgcggaagtggtgggccacggggaagtatggtcggcacgtctgatgtctgcggta
cttaatcaacaagggctgccagcggcctggcttgatgcccgcgagtttttacgcgctgaa
cgcgccgcacaaccgcaggttgatgaagggctttcttacccgttgctgcaacagctgctg
gtgcaacatccgggcaaacgtctggtggtgaccggatttatcagccgcaacaacgccggt
gaaacggtgctgctggggcgtaacggttccgactattccgcgacacaaatcggtgcgctg
gcgggtgtttctcgcgtaaccatctggagcgacgtcgccggggtatacagtgccgacccg
cgtaaagtgaaagatgcctgcctgctgccgttgctgcgtctggatgaggccagcgaactg
gcgcgcctggcggctcccgttcttcacgcccgtactttacagccggtttctggcagcgaa
atcgacctgcaactgcgctgtagctacacgccggatcaaggttccacgcgcattgaacgc
gtgctggcctccggtactggtgcgcgtattgtcaccagccacgatgatgtctgtttgatt
gagtttcaggtgcccgccagtcaggatttcaaactggcgcataaagagatcgaccaaatc
ctgaaacgcgcgcaggtacgcccgctggcggttggcgtacataacgatcgccagttgctg
caattttgctacacctcagaagtggccgacagtgcgctgaaaatcctcgacgaagcggga
ttacctggcgaactgcgcctgcgtcaggggctggcgctggtggcgatggtcggtgcaggc
gtcacccgtaacccgctgcattgccaccgcttctggcagcaactgaaaggccagccggtc
gaatttacctggcagtccgatgacggcatcagcctggtggcagtactgcgcaccggcccg
accgaaagcctgattcaggggctgcatcagtccgtcttccgcgcagaaaaacgcatcggc
ctggtattgttcggtaagggcaatatcggttcccgttggctggaactgttcgcccgtgag
cagagcacgctttcggcacgtaccggctttgagtttgtgctggcaggtgtggtggacagc
cgccgcagcctgttgagctatgacgggctggacgccagccgcgcgttagccttcttcaac
gatgaagcggttgagcaggatgaagagtcgttgttcctgtggatgcgcgcccatccgtat
gatgatttagtggtgctggacgttaccgccagccagcagcttgctgatcagtatcttgat
ttcgccagccacggtttccacgttatcagcgccaacaaactggcgggagccagcgacagc
aataaatatcgccagatccacgacgccttcgaaaaaaccgggcgtcactggctgtacaat
gccaccgtcggtgcgggcttgccgatcaaccacaccgtgcgcgatctgatcgacagcggc
gatactattttgtcgatcagcgggatcttctccggcacgctctcctggctgttcctgcaa
ttcgacggtagcgtgccgtttaccgagctggtggatcaggcgtggcagcagggcttaacc
gaacctgacccgcgtgacgatctctctggcaaagacgtgatgcgcaagctggtgattctg
gcgcgtgaagcaggttacaacatcgaaccggatcaggtacgtgtggaatcgctggtgcct
gctcattgcgaaggcggcagcatcgaccatttctttgaaaatggcgatgaactgaacgag
cagatggtgcaacggctggaagcggcccgcgaaatggggctggtgctgcgctacgtggcg
cgtttcgatgccaacggtaaagcgcgtgtaggcgtggaagcggtgcgtgaagatcatccg
ttggcatcactgctgccgtgcgataacgtctttgccatcgaaagccgctggtatcgcgat
aaccctctggtgatccgcggacctggcgctgggcgcgacgtcaccgccggggcgattcag
tcggatatcaaccggctggcacagttgttgtaa
              
                            

Download fasta file
RegulonDB