RegulonDB RegulonDB 10.10: Gene Sequence
metR gene sequence


Size: 954        A: 214  T: 203  G: 273  C: 264

Fasta

 

>metR E. coli K12. Version NC_000913.3 GI:556503834
atgatcgaagtaaaacacctgaaaacgctacaagcgttgcggaactgcggctcgctcgca
gccgctgcggcgacgttgcatcagacgcaatccgccctgtctcaccagtttagcgatctg
gaacaacgccttggcttccggctatttgtgcgtaagagccagccgctacgctttacaccg
cagggagaaatcctgttgcaactggcaaaccaggtactgccgcaaattagccaggccctg
caagcctgcaatgaaccgcagcagacgcgtctgcgcattgccattgagtgccatagctgt
attcagtggctgacacccgcgttagaaaatttccataagaactggccgcaggtagagatg
gattttaaatcgggcgtgacatttgacccgcagcccgccttgcaacagggagagctggat
ctggtaatgacgtccgatattctgccgcgcagtggcctgcattattcgccgatgttcgac
tatgaagtgcgtctggtgttagcacctgaccatccactggcggcgaaaacgcgaattaca
ccggaagatctcgccagcgagacgctattaatttatccggtgcagcgtagtcgactggat
gtctggcggcattttcttcagccggcaggcgtcagcccgtcactgaaaagcgtcgataac
accttattgttgattcagatggttgccgcgcggatgggtattgccgcgctaccgcattgg
gtagtagagagttttgagcgccagggtctggtggtgaccaaaaccctgggcgaaggcttg
tggagccgactgtacgccgccgtgcgcgatggcgagcagcgtcagccagttacggaagcg
tttattcgctcagcgcgcaatcacgcctgcgatcatctgccgtttgtgaagagcgcggag
cgacccacttacgatgcacccacagtgaggccaggatcaccagcgcgcctgtaa
              
                            

Download fasta file
RegulonDB