RegulonDB RegulonDB 10.9: Gene Sequence
mprA gene sequence


Size: 531        A: 147  T: 123  G: 128  C: 133

Fasta

 

>mprA E. coli K12. Version NC_000913.3 GI:556503834
atggatagttcgtttacgcccattgaacaaatgctaaaatttcgcgccagccgccacgaa
gattttccttatcaggagatccttctgactcgtctttgcatgcacatgcaaagcaagctg
ctggagaaccgcaataaaatgctgaaggctcaggggattaacgagacgttgtttatggcg
ttgattacgctggagtctcaggaaaaccacagtattcagccttctgaattaagttgtgct
cttggatcatcccgtaccaacgcgacgcgtattgccgatgaactggaaaaacgcggttgg
atcgaacgtcgtgaaagcgataacgatcgccgctgcctgcatctgcaattaacggaaaaa
ggtcacgagtttttgcgcgaggttttaccaccgcagcataactgcctgcatcaactctgg
tccgcgctcagcacaacagaaaaagatcagctcgagcaaatcacccgcaaattgctctcc
cgtctcgaccagatggaacaagacggtgtggttctcgaagcgatgagctaa
              
                            

Download fasta file
RegulonDB