RegulonDB RegulonDB 10.9: Gene Sequence
mtr gene sequence


Size: 1245        A: 226  T: 358  G: 362  C: 299

Fasta

 

>mtr E. coli K12. Version NC_000913.3 GI:556503834
atggcaacactaaccaccacccaaacgtcaccgtcgctgcttggcggcgtggtgattatc
ggcggcaccattattggcgcagggatgttttctctgccagtggtcatgtccggggcgtgg
tttttctggtcaatggcggcgctgatctttacctggttctgtatgctgcattccggcttg
atgattctggaagctaacctgaattacagaatcggttcgagttttgacaccatcaccaaa
gatttgctgggcaaaggctggaacgtggtcaacggcatttccattgcctttgtgctctat
atcctgacctatgcctatatttctgccagtggttcgattctgcatcacaccttcgcagag
atgtcactaaacgtcccggcacgggcggcgggttttggttttgcattgctggtagcgttt
gtggtgtggttgagcactaaagccgtcagtcgcatgacagcgattgtgctgggggcgaaa
gtcattaccttcttcctcacctttggtagcctgctggggcatgtgcagcctgcgacattg
ttcaacgtcgccgaaagcaatgcgtcttatgcaccgtatctgttgatgaccctgccgttc
tgtctggcatcgtttggttatcacggtaacgtgccaagcctgatgaagtattacggcaaa
gatccgaaaaccatcgtgaaatgtctggtgtacggtacgctgatggcgctggcgctgtat
accatctggttgctggcgacgatgggtaacatcccgcgtccggagtttatcggtattgca
gagaagggcggtaatattgatgtgctggtacaggcgttaagcggcgtactgaacagccgt
agtctggatctgctgctggtcgtgttctcaaactttgcggtagcgagttcgttcctcggc
gtaacgctgggtttgtttgactatctggcagatctgtttggtttcgacgactcggctgtg
ggccgcttgaaaacggcattgctgacctttgccccgccagttgtgggggggctgttgttc
ccgaacggattcctgtacgccattggttatgctggtttagcggctaccatctgggcggca
attgttccggcgctgttagcccgtgcatcgcgtaaacgctttggcagcccgaaattccgc
gtctggggtggcaagccgatgattgcgctgattctggtgtttggcgtcggcaacgcactg
gtgcatattttatcgagctttaatttactgccggtgtatcagtaa
              
                            

Download fasta file
RegulonDB