RegulonDB RegulonDB 10.9: Gene Sequence
fpr gene sequence


Size: 747        A: 193  T: 154  G: 206  C: 194

Fasta

 

>fpr E. coli K12. Version NC_000913.3 GI:556503834
atggctgattgggtaacaggcaaagtcactaaagtgcagaactggaccgacgccctgttt
agtctcaccgttcacgcccccgtgcttccgtttaccgccgggcaatttaccaagcttggc
cttgaaatcgacggcgaacgcgtccagcgcgcctactcctatgtaaactcgcccgataat
cccgatctggagttttacctggtcaccgtccccgatggcaaattaagcccacgactggcg
gcactgaaaccaggcgatgaagtgcaggtggttagcgaagcggcaggattctttgtgctc
gatgaagtgccgcactgcgaaacgctatggatgctggcaaccggtacagcgattggccct
tatttatcgattctgcaactaggtaaagatttagatcgcttcaaaaatctggtcctggtg
cacgccgcacgttatgccgccgacttaagctatttgccactgatgcaggaactggaaaaa
cgctacgaaggaaaactgcgcattcagacggtggtcagtcgggaaacggcagcggggtcg
ctcaccggacggataccggcattaattgaaagtggggaactggaaagcacgattggcctg
ccgatgaataaagaaaccagccatgtgatgctgtgcggcaatccacagatggtgcgcgat
acacaacagttgctgaaagagacccggcagatgacgaaacatttacgtcgccgaccgggc
catatgacagcggagcattactggtaa
              
                            

Download fasta file
RegulonDB