RegulonDB RegulonDB 10.8: Gene Sequence
nadB gene sequence


Size: 1623        A: 371  T: 389  G: 451  C: 412

Fasta

 

>nadB E. coli K12. Version NC_000913.3 GI:556503834
atgaatactctccctgaacattcatgtgacgtgttgattatcggtagcggcgcagccgga
ctttcactggcgctacgcctggctgaccagcatcaggtcatcgttctaagtaaaggcccg
gtaacggaaggttcaacattttatgcccagggcggtattgccgccgtgtttgatgaaact
gacagcattgactcgcatgtggaagacacattgattgccggggctggtatttgcgatcgc
catgcagttgaatttgtcgccagcaatgcacgatcctgtgtgcaatggctaatcgaccag
ggggtgttgtttgatacccacattcaaccgaatggcgaagaaagttaccatctgacccgt
gaaggtggacatagtcaccgtcgtattcttcatgccgccgacgccaccggtagagaagta
gaaaccacgctggtgagcaaggcgctgaaccatccgaatattcgcgtgctggagcgcagc
aacgcggttgatctgattgtttctgacaaaattggcctgccgggcacgcgacgggttgtt
ggcgcgtgggtatggaaccgtaataaagaaacggtggaaacctgccacgcaaaagcggtg
gtgctggcaaccggcggtgcgtcgaaggtttatcagtacaccaccaatccggatatttct
tctggcgatggcattgctatggcgtggcgcgcaggctgccgggttgccaatctcgaattt
aatcagttccaccctaccgcgctatatcacccacaggcacgcaatttcctgttaacagaa
gcactgcgcggcgaaggcgcttatctcaagcgcccggatggtacgcgttttatgcccgat
tttgatgagcgcggcgaactggccccgcgcgatattgtcgcccgcgccattgaccatgaa
atgaaacgcctcggcgcagattgtatgttccttgatatcagccataagcccgccgatttt
attcgccagcatttcccgatgatttatgaaaagctgctcgggctggggattgatctcaca
caagaaccggtaccgattgtgcctgctgcacattatacctgcggtggtgtaatggttgat
gatcatgggcgtacggacgtcgagggcttgtatgccattggcgaggtgagttataccggc
ttacacggcgctaaccgcatggcctcgaattcattgctggagtgtctggtctatggctgg
tcggcggcggaagatatcaccagacgtatgccttatgcccacgacatcagtacgttaccg
ccgtgggatgaaagccgcgttgagaaccctgacgaacgggtagtaattcagcataactgg
cacgagctacgtctgtttatgtgggattacgttggcattgtgcgcacaacgaagcgcctg
gaacgcgccctgcggcggataaccatgctccaacaagaaatagacgaatattacgcccat
ttccgcgtctcaaataatttgctggagctgcgtaatctggtacaggttgccgagttgatt
gttcgctgtgcaatgatgcgtaaagagagtcgggggttgcatttcacgctggattatccg
gaactgctcacccattccggtccgtcgatcctttcccccggcaatcattacataaacaga
taa
              
                            

Download fasta file
RegulonDB