RegulonDB RegulonDB 10.8: Gene Sequence
nagE gene sequence


Size: 1947        A: 399  T: 482  G: 568  C: 498

Fasta

 

>nagE E. coli K12. Version NC_000913.3 GI:556503834
atgaatattttaggttttttccagcgactcggtagggcgttacagctccctatcgcggtg
ctgccggtggcggcactgttgctgcgattcggtcagccagatttacttaacgttgcgttt
attgcccaggcgggcggtgcgatttttgataacctcgcattaatcttcgccatcggtgtg
gcatccagctggtcgaaagacagcgctggtgcggcggcgctggcgggtgcggtaggttac
tttgtgttaaccaaagcgatggtgaccatcaacccagaaattaacatgggtgtactggcg
ggtatcattaccggtctggttggtggcgcagcctataaccgttggtccgatattaaactg
ccggacttcctgagcttcttcggcggcaaacgctttgtgccgattgccaccggattcttc
tgcctggtgctggcggccatttttggttacgtctggccgccggtacagcacgctatccat
gcaggcggcgagtggatcgtttctgcgggcgcgctgggttccggtatctttggtttcatc
aaccgtctgctgatcccaaccggtctgcatcaggtactgaacaccatcgcctggttccag
attggtgaattcaccaacgcggcgggtacggttttccacggtgacattaaccgcttctat
gccggtgacggcaccgcggggatgttcatgtccggcttcttcccgatcatgatgttcggt
ctgccgggtgcggcgctggcgatgtacttcgcagcaccgaaagagcgtcgtccgatggtt
ggcggtatgctgctttctgttgctgttactgcgttcctgaccggtgtgactgagccgctg
gaattcctgttcatgttccttgctccgctgctgtacctcctgcacgcactgctgaccggt
atcagcctgtttgtggcaacgctgctgggtatccacgcgggcttctctttctctgcgggg
gctatcgactacgcgttgatgtataacctgccggccgccagccagaacgtctggatgctg
ctggtgatgggcgttatcttcttcgctatctacttcgtggtgttcagtttggttatccgc
atgttcaacctgaaaacgccgggtcgtgaagataaagaagacgagatcgttactgaagaa
gccaacagcaacactgaagaaggtctgactcaactggcaaccaactatattgctgcggtt
ggcggcactgacaacctgaaagcgattgacgcctgtatcacccgtctgcgccttacagtg
gctgactctgcccgcgttaacgatacgatgtgtaaacgtctgggtgcttctggggtagtg
aaactgaacaaacagactattcaggtgattgttggcgcgaaagcagaatccatcggcgat
gcgatgaagaaagtcgttgcccgtggtccggtagccgctgcgtcagctgaagcaactccg
gcaactgccgcgcctgtagcaaaaccgcaggctgtaccaaacgcggtatctatcgcggag
ctggtatcgccgattaccggtgatgtcgtggcactggatcaggttcctgacgaagcattc
gccagcaaagcggtgggtgacggtgtggcggtgaaaccgacagataaaatcgtcgtatca
ccagccgcagggacaatcgtgaaaatcttcaacaccaaccacgcgttctgcctggaaacc
gaaaaaggcgcggagatcgtcgtccatatgggtatcgacaccgtagcgctggaaggtaaa
ggctttaaacgtctggtggaagagggtgcgcaggtaagcgcagggcaaccgattctggaa
atggatctggattacctgaacgctaacgcccgctcgatgattagcccggtggtttgcagc
aatatcgacgatttcagtggcttgatcattaaagctcagggccatattgtggcgggtcaa
acaccgctgtatgaaatcaaaaagtaa
              
                            

Download fasta file
RegulonDB