RegulonDB RegulonDB 10.9: Gene Sequence
narV gene sequence


Size: 681        A: 126  T: 196  G: 195  C: 164

Fasta

 

>narV E. coli K12. Version NC_000913.3 GI:556503834
atgattcagtatctgaacgtctttttttacgatatctacccgtacatttgtgcgacggtg
tttttcctcggcagctggctgcgctacgactacgggcagtacacctggcgcgcctcctca
agtcaaatgctcgataaacgcgggatggtgatatggtcgaatctgttccatatcggcatt
ttggggattttcttcgggcacttgttcggcatgttaacgccgcactggatgtacgcgtgg
tttttgccagtggcagcgaaacaactcatggcgatggtgctcggcggtatttgcggtgtg
ttgacgttgattggcggcgcaggactgctgtggcgcaggctgacaaatcagcgcgtgcgt
gccacttccactacgccggatatcatcatcatgagcattttgctgatccagtgtctgttg
gggctaagtaccataccgttttcagcacagtatcctgatggtagcgaaatgatgaagctg
gtgggttgggcgcaaagcattgtcactttccgtggtggatcgtcagagatgctcaacggc
gtagcgttcgtcttccgcctgcatctggtgttgggaatgaccatcttcctgctcttcccg
ttcacccgactggtgcatgtgtggagcgcgccgtttgagtactttactcgtcgatatcaa
attgtgcgttcgcggcgataa
              
                            

Download fasta file
RegulonDB