RegulonDB RegulonDB 10.7: Gene Sequence
nhaA gene sequence


Size: 1167        A: 213  T: 354  G: 337  C: 263

Fasta

 

>nhaA E. coli K12. Version NC_000913.3 GI:556503834
gtgaaacatctgcatcgattctttagcagtgatgcctcgggaggcattattcttatcatt
gccgctatcctggcgatgattatggccaacagcggcgcaaccagtggatggtatcacgac
tttctggagacgccggttcagctccgggttggttcactcgaaatcaacaaaaacatgctg
ttatggataaatgacgcgctgatggcggtatttttcctgttagtcggtctggaagttaaa
cgtgaactgatgcaaggatcgctagccagcttacgccaggccgcatttccagttatcgcc
gctattggtgggatgattgtgccggcattactctatctggcttttaactatgccgatccg
attacccgcgaagggtgggcgatcccggcggctactgacattgcttttgcacttggtgta
ctggcgctgttgggaagtcgtgttccgttagcgctgaagatctttttgatggctctggct
attatcgacgatcttggggccatcattatcatcgcattgttctacactaatgacttatcg
atggcctctcttggcgtcgcggctgtagcaattgcggtactcgcggtattgaatctgtgt
ggtgcacgccgcacgggcgtctatattcttgttggcgtggtgttgtggactgcggtgttg
aaatcgggggttcacgcaactctggcgggggtaattgtcggcttctttattcctttgaaa
gagaagcatgggcgttctccagcgaagcgactggagcatgtgttgcacccgtgggtggcg
tatctgattttgccgctgtttgcatttgctaatgctggcgtttcactgcaaggcgtcacg
ctggatggcttgacctccattctgccattggggatcatcgctggcttgctgattggcaaa
ccgctggggattagtctgttctgctggttggcgctgcgtttgaaactggcgcatctgcct
gagggaacgacttatcagcaaattatggtggtggggatcctgtgcggtatcggttttact
atgtctatctttattgccagcctggcctttggtagcgtagatccagaactgattaactgg
gcgaaactcggtatcctggtcggttctatctcttcggcggtaattggatacagctggtta
cgcgttcgtttgcgtccatcagtttga
              
                            

Download fasta file
RegulonDB