RegulonDB RegulonDB 10.9: Gene Sequence
nrdB gene sequence


Size: 1131        A: 285  T: 274  G: 286  C: 286

Fasta

 

>nrdB E. coli K12. Version NC_000913.3 GI:556503834
atggcatataccaccttttcacagacgaaaaatgatcagctcaaagaaccgatgttcttt
ggtcagccggtcaacgtggctcgctacgatcagcaaaaatatgacatcttcgaaaagctg
atcgaaaagcagctctctttcttctggcgtccggaagaagttgacgtctcccgcgaccgt
atagattaccaggcgctgccggagcacgaaaaacacatctttatcagcaacctgaaatat
cagacgctgctggattccattcagggtcgtagcccgaacgtggcgctattgccgcttatt
tctattccggaactggaaacctgggtcgaaacctgggcgttctcagaaacgattcattcc
cgttcctatactcatatcattcgtaatatcgttaacgatccgtctgttgtgtttgacgat
atcgtcaccaacgagcagatccagaaacgtgcggaagggatctccagctattacgatgag
ctgatcgaaatgaccagctactggcatctgctgggcgaaggtacccacaccgttaacggt
aaaactgtgaccgttagcctgcgcgagctgaagaaaaaactgtatctctgcctgatgagc
gttaacgcgctggaagcgattcgtttctacgtcagctttgcttgttccttcgcatttgca
gaacgcgaattgatggaaggcaacgccaaaattattcgcctgattgcccgcgacgaagcc
ctgcacctgaccggcacccagcatatgctgaatctgctgcgcagcggcgcggacgatcct
gagatggcggaaattgccgaagagtgtaagcaggagtgctatgacctgtttgttcaggca
gctcaacaggagaaagactgggcggattatctgttccgcgacggttcgatgattggtctg
aataaagacattctctgccagtacgttgaatacatcaccaatatccgtatgcaggcagtc
ggtttggatctgccgttccagacgcgctccaacccgatcccgtggatcaacacttggctg
gtgtctgataacgtgcaggttgctccgcaggaagtggaagtcagttcttatctggtcggg
cagattgactcggaagtggacaccgacgatttgagtaacttccagctctga
              
                            

Download fasta file
RegulonDB