RegulonDB RegulonDB 10.8: Gene Sequence
nusB gene sequence


Size: 420        A: 107  T: 87  G: 115  C: 111

Fasta

 

>nusB E. coli K12. Version NC_000913.3 GI:556503834
gtgaaacctgctgctcgtcgccgcgctcgtgagtgtgccgtccaggcgctctactcctgg
cagttgtcccagaacgacatcgctgatgttgaataccagttcctggctgaacaggatgta
aaagacgttgacgtcctgtacttccgtgagctgctggccggggtggcgactaataccgca
tacctcgacggactgatgaagccatacctgtcccgcctgctggaagaactgggacaggta
gaaaaagcagtactgcgcattgcgctgtacgaactgtctaaacgtagcgatgtgccatac
aaagtggccattaacgaagcgatcgaactggcgaaatcgttcggcgcagaagacagccat
aagttcgtcaacggcgtactcgataaagcagcacctgtgattcgccctaacaaaaagtga
              
                            

Download fasta file
RegulonDB