RegulonDB RegulonDB 11.0: Gene Sequence
ompR gene sequence


Size: 720        A: 160  T: 163  G: 209  C: 188

Fasta

 

>ompR E. coli K12. Version NC_000913.3 GI:556503834
atgcaagagaactacaagattctggtggtcgatgacgacatgcgcctgcgtgcgctgctg
gaacgttatctcaccgaacaaggcttccaggttcgaagcgtcgctaatgcagaacagatg
gatcgcctgctgactcgtgaatctttccatcttatggtactggatttaatgttacctggt
gaagatggcttgtcgatttgccgacgtcttcgtagtcagagcaacccgatgccgatcatt
atggtgacggcgaaaggggaagaagtggaccgtatcgtaggcctggagattggcgctgac
gactacattccaaaaccgtttaacccgcgtgaactgctggcccgtatccgtgcggtgctg
cgtcgtcaggcgaacgaactgccaggcgcaccgtcacaggaagaggcggtaattgctttc
ggtaagttcaaacttaacctcggtacgcgcgaaatgttccgcgaagacgagccgatgccg
ctcaccagcggtgagtttgcggtactgaaggcactggtcagccatccgcgtgagccgctc
tcccgcgataagctgatgaaccttgcccgtggtcgtgaatattccgcaatggaacgctcc
atcgacgtgcagatttcgcgtctgcgccgcatggtggaagaagatccagcgcatccgcgt
tacattcagaccgtctggggtctgggctacgtctttgtaccggacggctctaaagcatga
              
                            

Download fasta file
RegulonDB