RegulonDB RegulonDB 11.1: Gene Sequence
oppB gene sequence


Size: 921        A: 203  T: 297  G: 216  C: 205

Fasta

 

>oppB E. coli K12. Version NC_000913.3 GI:556503834
atgttaaaatttattctacgtcgctgtctggaagcgattccgacgctatttattcttatt
actatttcgttctttatgatgcgcctcgcgccgggaagcccttttaccggcgaacgtact
ttaccgccagaagtgatggccaatatcgaagcgaaatatcatcttaatgatccgatcatg
acacagtatttcagctacctgaaacaactggcgcacggtgatttcggtccatcgtttaaa
tataaagattattcggtcaatgacttggttgcatccagttttcccgtttctgccaaactg
ggagccgcagcatttttccttgcggtaatactgggtgttagtgctggcgttattgccgca
ttaaaacaaaacaccaaatgggactataccgtgatggggctggcaatgaccggggttgtt
atccccagttttgtggttgcaccattattagtcatgatatttgcgatcattttgcattgg
ctgccgggcggtggctggaatggtggggcgcttaaattcatgatattgccgatggtggcg
ttgtcactcgcttatatcgccagtattgcgcgtattacccgtggctctatgattgaagta
ttacactccaattttattcgtactgcccgggcgaaagggttacctatgcggcggatcatt
ttacgtcacgcattaaaacctgctctgttacccgtgctctcttatatgggccccgcattt
gtcggcattattaccggttctatggttatcgaaaccatttatggtttgccggggattgga
caactgttcgttaatggcgcattgaaccgtgactattccttagtgttaagcctgaccatc
ctggttggtgctttaaccattttgtttaatgccattgtcgatgtgctatatgcggttatc
gacccgaaaatccgttactga
              
                            

Download fasta file
RegulonDB