RegulonDB RegulonDB 11.2: Gene Sequence
oppF gene sequence


Size: 1005        A: 235  T: 252  G: 273  C: 245

Fasta

 

>oppF E. coli K12. Version NC_000913.3 GI:556503834
atgaatgctgtaactgaaggaagaaaagtcctccttgaaatcgccgatcttaaagtgcac
tttgaaatcaaagatggcaaacagtggttctggcaaccgccgaaaacgctcaaagccgtc
gatggtgtcactcttcgcctgtatgaaggggaaacattaggtgtggtaggggaatcggga
tgcggtaagtccacctttgctcgcgccatcatcggtttggtcaaggcgaccgacggtcat
gttgcctggttaggtaaagagttgctgggcatgaaacccgatgaatggcgtgccgttcgc
agtgatattcagatgattttccaggatccgttggcatcgctaaacccgcgtatgaccatc
ggcgagatcatcgctgaaccactgcgtacttatcatccgaaaatgtcacgccaggaagtt
cgcgagcgcgtgaaggcgatgatgctgaaagtcgggttattgcctaacctgattaaccgc
tatccgcatgagttctctggtgggcagtgccagcgtatcgggattgcgcgtgctcttatt
cttgaaccgaagctgattatctgtgatgagccggtgtcggcgctggacgtgtcaattcag
gcacaggtggtcaacctgctccagcaattgcaacgtgagatgggattgtcattaattttt
atcgctcatgacctggccgtggtaaaacacatttccgatcgtgtgttggtgatgtatctc
ggccatgcggtagaactggggacctatgatgaggtctaccacaatccactacatccttac
accagggcattgatgtcggcagtccccatacctgatccggatctggagaagaacaaaacc
atccagttactggaaggggaattaccgtcgccgatcaacccgccttccggttgtgttttc
cgtacccgttgcccgattgccggtccagagtgcgccaaaacacgtcctgttctggagggg
agtttcagacactccgtttcttgcctgaaagtcgatccgctttaa
              
                            

Download fasta file
RegulonDB