RegulonDB RegulonDB 10.7: Gene Sequence
osmC gene sequence


Size: 432        A: 126  T: 90  G: 121  C: 95

Fasta

 

>osmC E. coli K12. Version NC_000913.3 GI:556503834
atgacaatccataagaaaggtcaggcacactgggaaggcgatatcaaacgcgggaaggga
acagtatccaccgagagtggcgtgctgaaccaacagccgtatggatttaacacgcgtttt
gaaggcgaaaaaggaaccaaccctgaagaactgattggcgcagcgcatgccgcatgtttc
tcaatggcgctttcattaatgctgggggaagcgggattcacgccaacatcgattgatacc
accgccgatgtgtcgctggataaagtggatgccggttttgcgattacgaaaatcgcactg
aagagtgaagttgcggtgccgggtattgatgcctctacctttgacggcataatccagaaa
gcaaaagcaggatgcccggtctctcaggtactgaaagcggaaattacgctggattaccag
ttgaaatcgtaa
              
                            

Download fasta file
RegulonDB