RegulonDB RegulonDB 10.8: Gene Sequence
pdxA gene sequence


Size: 990        A: 205  T: 227  G: 281  C: 277

Fasta

 

>pdxA E. coli K12. Version NC_000913.3 GI:556503834
atggttaaaacccaacgtgttgtgatcactcccggcgagcccgccgggattggcccggac
ttagttgtccagcttgcacagcgtgagtggccggtcgaactggttgtttgtgccgatgcc
actctccttaccaaccgggcagcgatgctcggtttgccgctcaccctccgcccttattcc
cccaactcccctgcacaaccgcaaactgcgggcacattaacgctacttcctgtcgcgcta
cgtgcacctgtcactgcggggcagttagcggttgaaaatgggcattatgtggtggaaacg
ctggcgcgagcgtgcgatggttgtctgaacggcgaatttgccgcgctgatcacaggtccg
gtgcataaaggcgttattaacgacgctggcattccttttaccggtcataccgagtttttc
gaagagcgttcgcaggcgaaaaaggtggtgatgatgctggcgaccgaagaacttcgcgtg
gcgctggcaacgacgcatttaccgctgcgcgatatcgcagacgctatcacccctgcactt
ttgcacgaagtgattgctattttgcatcacgatttgcggaccaaatttggtattgccgaa
ccgcgcattctggtctgcgggctgaatccgcacgcgggcgaaggcggtcatatgggtacg
gaagagatagacaccattattccggtgctcaatgagctgcgggcgcaggggatgaaactc
aacgggccgctgcctgccgataccctgtttcagccgaaatatcttgataacgccgacgcc
gtgctggcgatgtaccacgatcagggtcttcccgtgctaaaataccagggcttcgggcgc
ggtgtgaacattacgctgggcctgccctttattcgcacatcagtggaccacggcaccgcg
cttgaactggcgggacgtggcaaagccgatgtcggcagttttattacggcgcttaatctc
gccatcaaaatgattgttaacacccaatga
              
                            

Download fasta file
RegulonDB