RegulonDB RegulonDB 10.8: Gene Sequence
pepN gene sequence


Size: 2613        A: 619  T: 597  G: 704  C: 693

Fasta

 

>pepN E. coli K12. Version NC_000913.3 GI:556503834
atgactcaacagccacaagccaaataccgtcacgattatcgtgcgccggattaccagatt
actgatattgacttgacctttgacctcgacgcgcaaaagacggtcgttaccgcggtcagc
caggctgtccgtcatggtgcatcagatgctccccttcgtctcaacggcgaagacctcaaa
ctggtttctgttcatattaatgatgagccgtggaccgcctggaaagaagaagagggcgca
ctggttatcagtaatttgccggagcgttttacgcttaagatcattaatgaaataagcccg
gcggcgaataccgcgctggaagggctttatcagtcaggcgatgcgctttgcacccagtgt
gaagccgaaggtttccgccatattacgtattatctcgaccgcccggacgtgctggcgcgt
tttaccaccaaaattattgccgataaaatcaaatatcccttcctgctttccaatggtaac
cgcgttgcgcaaggcgaactggaaaacggacgccattgggtacagtggcaggacccgttc
ccgaaaccgtgctacctgtttgcgctggtggcaggcgactttgatgtactgcgcgatacc
tttaccacgcgttctggtcgcgaagtagcactggagctgtacgtcgatcgcggcaacctt
gatcgcgcgccgtgggcgatgacctcgctgaaaaactccatgaaatgggatgaagaacgc
tttggcctggagtatgacctcgacatctatatgatcgtcgcggtggatttcttcaatatg
ggcgcaatggagaataaggggctgaatatctttaactccaaatatgtgctggcccgcacc
gacaccgccaccgacaaagattacctcgatattgaacgcgttatcggccatgaatatttc
cataactggaccggtaaccgagtgacctgtcgcgactggttccagctcagcctgaaagaa
ggtttaaccgtcttccgcgatcaggagttcagctctgaccttggttcccgcgcagttaac
cgcatcaataatgtacgcaccatgcgcggattgcagtttgcagaagacgccagcccgatg
gcgcacccgatccgcccggatatggtcattgagatgaacaacttctacaccctgaccgtt
tacgagaagggcgcggaagtgattcgcatgatccacaccctgcttggcgaagaaaacttc
cagaaagggatgcagctttatttcgagcgtcatgatggtagtgcagcgacctgtgacgac
tttgtgcaggcgatggaagatgcgtcgaatgtcgatctctcccatttccgccgttggtac
agccagtccggtacaccgattgtgaccgtcaaagacgactacaatccggaaaccgagcag
tacaccctgaccatcagccagcgcacgccagccacgccggatcaggcagaaaaacagccg
ctgcatattccgtttgccatcgaactgtatgataacgaaggcaaagtgatcccgttgcag
aaaggcggtcatccggtgaattccgtgctgaacgtcactcaggcggaacagacctttgtc
tttgataatgtctacttccagccggtgcctgcgctgctgtgcgaattctctgcgccagtg
aaactggaatataagtggagcgatcagcaactgaccttcctgatgcgtcatgcgcgtaat
gatttctcccgctgggatgcggcgcaaagtttgctggcaacctacatcaagctgaacgtc
gcgcgtcatcagcaaggtcagccgctgtctctgccggtgcatgtggctgatgctttccgc
gcggtactgcttgatgagaagattgatccagcgctggcggcagaaatcctgacgctgcct
tctgtcaatgaaatggctgaattgttcgatatcatcgacccgattgctattgccgaagta
cgcgaagcactcactcgtactctggcgactgaactggcggatgagctactggctatttac
aacgcgaattaccagagcgagtaccgtgttgagcatgaagatattgcaaaacgcactctg
cgtaatgcctgcctgcgtttcctcgcttttggtgaaacgcatctggctgatgtgctggtg
agcaagcagttccacgaagcaaacaatatgactgatgcgctggcggcgctttctgcggcg
gttgccgcacagctgccttgccgtgacgcgctgatgcaggagtacgacgacaagtggcat
cagaacggtctggtgatggataaatggtttatcctgcaagccaccagcccggcggcgaat
gtgctggagacggtgcgcggcctgttgcagcatcgctcatttaccatgagcaacccgaac
cgtattcgttcgttgattggcgcgtttgcgggcagcaatccggcagcgttccatgccgaa
gatggcagcggttacctgttcctggtggaaatgcttaccgacctcaacagccgtaacccg
caggtggcttcacgtctgattgaaccgctgattcgcctgaaacgttacgatgccaaacgt
caggagaaaatgcgcgcggcgctggaacagttgaaagggctggaaaatctctctggcgat
ctgtacgagaagataactaaagcactggcttga
              
                            

Download fasta file
RegulonDB