RegulonDB RegulonDB 10.9: Gene Sequence
pfkA gene sequence


Size: 963        A: 217  T: 231  G: 283  C: 232

Fasta

 

>pfkA E. coli K12. Version NC_000913.3 GI:556503834
atgattaagaaaatcggtgtgttgacaagcggcggtgatgcgccaggcatgaacgccgca
attcgcggggttgttcgttctgcgctgacagaaggtctggaagtaatgggtatttatgac
ggctatctgggtctgtatgaagaccgtatggtacagctagaccgttacagcgtgtctgac
atgatcaaccgtggcggtacgttcctcggttctgcgcgtttcccggaattccgcgacgag
aacatccgcgccgtggctatcgaaaacctgaaaaaacgtggtatcgacgcgctggtggtt
atcggcggtgacggttcctacatgggtgcaatgcgtctgaccgaaatgggcttcccgtgc
atcggtctgccgggcactatcgacaacgacatcaaaggcactgactacactatcggtttc
ttcactgcgctgagcaccgttgtagaagcgatcgaccgtctgcgtgacacctcttcttct
caccagcgtatttccgtggtggaagtgatgggccgttattgtggagatctgacgttggct
gcggccattgccggtggctgtgaattcgttgtggttccggaagttgaattcagccgtgaa
gacctggtaaacgaaatcaaagcgggtatcgcgaaaggtaaaaaacacgcgatcgtggcg
attaccgaacatatgtgtgatgttgacgaactggcgcatttcatcgagaaagaaaccggt
cgtgaaacccgcgcaactgtgctgggccacatccagcgcggtggttctccggtgccttac
gaccgtattctggcttcccgtatgggcgcttacgctatcgatctgctgctggcaggttac
ggcggtcgttgtgtaggtatccagaacgaacagctggttcaccacgacatcatcgacgct
atcgaaaacatgaagcgtccgttcaaaggtgactggctggactgcgcgaaaaaactgtat
taa
              
                            

Download fasta file
RegulonDB