RegulonDB RegulonDB 10.9: Gene Sequence
pfkB gene sequence


Size: 930        A: 233  T: 194  G: 262  C: 241

Fasta

 

>pfkB E. coli K12. Version NC_000913.3 GI:556503834
atggtacgtatctatacgttgacacttgcgccctctctcgatagcgcaacaattaccccg
caaatttatcccgaaggaaaactgcgctgtaccgcaccggtgttcgaacccgggggcggc
ggcatcaacgtcgcccgcgccattgcccatcttggaggcagtgccacagcgatcttcccg
gcgggtggcgcgaccggcgaacacctggtttcactgttggcggatgaaaatgtccccgtc
gctactgtagaagccaaagactggacccggcagaatttacacgtacatgtggaagcaagc
ggtgagcagtatcgttttgttatgccaggcgcggcattaaatgaagatgagtttcgccag
cttgaagagcaagttctggaaattgaatccggggccatcctggtcataagcggaagcctg
ccgccaggtgtgaagctggaaaaattaacccaactgatttccgctgcgcaaaaacaaggg
atccgctgcatcgtcgacagttctggcgaagcgttaagtgcagcactggcaattggtaac
atcgagttggttaagcctaaccaaaaagaactcagtgcgctggtgaatcgcgaactcacc
cagccggacgatgtccgcaaagccgcgcaggaaatcgttaatagcggcaaggccaaacgg
gttgtcgtttccctgggtccacaaggagcgctgggtgttgatagtgaaaactgtattcag
gtggtgccaccaccggtgaaaagccagagtaccgttggcgctggtgacagcatggtcggc
gcgatgacactgaaactggcagaaaatgcctctcttgaagagatggttcgttttggcgta
gctgcggggagtgcagccacactcaatcagggaacacgtctgtgctcccatgacgatacg
caaaaaatttacgcttacctttcccgctaa
              
                            

Download fasta file
RegulonDB