RegulonDB RegulonDB 10.9: Gene Sequence
pflB gene sequence


Size: 2283        A: 590  T: 524  G: 561  C: 608

Fasta

 

>pflB E. coli K12. Version NC_000913.3 GI:556503834
atgtccgagcttaatgaaaagttagccacagcctgggaaggttttaccaaaggtgactgg
cagaatgaagtaaacgtccgtgacttcattcagaaaaactacactccgtacgagggtgac
gagtccttcctggctggcgctactgaagcgaccaccaccctgtgggacaaagtaatggaa
ggcgttaaactggaaaaccgcactcacgcgccagttgactttgacaccgctgttgcttcc
accatcacctctcacgacgctggctacatcaacaagcagcttgagaaaatcgttggtctg
cagactgaagctccgctgaaacgtgctcttatcccgttcggtggtatcaaaatgatcgaa
ggttcctgcaaagcgtacaaccgcgaactggatccgatgatcaaaaaaatcttcactgaa
taccgtaaaactcacaaccagggcgtgttcgacgtttacactccggacatcctgcgttgc
cgtaaatctggtgttctgaccggtctgccagatgcatatggccgtggccgtatcatcggt
gactaccgtcgcgttgcgctgtacggtatcgactacctgatgaaagacaaactggcacag
ttcacttctctgcaggctgatctggaaaacggcgtaaacctggaacagactatccgtctg
cgcgaagaaatcgctgaacagcaccgcgctctgggtcagatgaaagaaatggctgcgaaa
tacggctacgacatctctggtccggctaccaacgctcaggaagctatccagtggacttac
ttcggctacctggctgctgttaagtctcagaacggtgctgcaatgtccttcggtcgtacc
tccaccttcctggatgtgtacatcgaacgtgacctgaaagctggcaagatcaccgaacaa
gaagcgcaggaaatggttgaccacctggtcatgaaactgcgtatggttcgcttcctgcgt
actccggaatacgatgaactgttctctggcgacccgatctgggcaaccgaatctatcggt
ggtatgggcctcgacggtcgtaccctggttaccaaaaacagcttccgtttcctgaacacc
ctgtacaccatgggtccgtctccggaaccgaacatgaccattctgtggtctgaaaaactg
ccgctgaacttcaagaaattcgccgctaaagtgtccatcgacacctcttctctgcagtat
gagaacgatgacctgatgcgtccggacttcaacaacgatgactacgctattgcttgctgc
gtaagcccgatgatcgttggtaaacaaatgcagttcttcggtgcgcgtgcaaacctggcg
aaaaccatgctgtacgcaatcaacggcggcgttgacgaaaaactgaaaatgcaggttggt
ccgaagtctgaaccgatcaaaggcgatgtcctgaactatgatgaagtgatggagcgcatg
gatcacttcatggactggctggctaaacagtacatcactgcactgaacatcatccactac
atgcacgacaagtacagctacgaagcctctctgatggcgctgcacgaccgtgacgttatc
cgcaccatggcgtgtggtatcgctggtctgtccgttgctgctgactccctgtctgcaatc
aaatatgcgaaagttaaaccgattcgtgacgaagacggtctggctatcgacttcgaaatc
gaaggcgaatacccgcagtttggtaacaatgatccgcgtgtagatgacctggctgttgac
ctggtagaacgtttcatgaagaaaattcagaaactgcacacctaccgtgacgctatcccg
actcagtctgttctgaccatcacttctaacgttgtgtatggtaagaaaacgggtaacacc
ccagacggtcgtcgtgctggcgcgccgttcggaccgggtgctaacccgatgcacggtcgt
gaccagaaaggtgcagtagcctctctgacttccgttgctaaactgccgtttgcttacgct
aaagatggtatctcctacaccttctctatcgttccgaacgcactgggtaaagacgacgaa
gttcgtaagaccaacctggctggtctgatggatggttacttccaccacgaagcatccatc
gaaggtggtcagcacctgaacgttaacgtgatgaaccgtgaaatgctgctcgacgcgatg
gaaaacccggaaaaatatccgcagctgaccatccgtgtatctggctacgcagtacgtttc
aactcgctgactaaagaacagcagcaggacgttattactcgtaccttcactcaatctatg
taa
              
                            

Download fasta file
RegulonDB