RegulonDB RegulonDB 10.8: Gene Sequence
pgpA gene sequence


Size: 519        A: 95  T: 148  G: 159  C: 117

Fasta

 

>pgpA E. coli K12. Version NC_000913.3 GI:556503834
atgaccattttgccacgccataaagatgtcgcgaaaagtcgcctgaagatgagtaatccg
tggcatctacttgctgtcggattcggaagtggattaagcccgatcgttcctgggacgatg
ggctcgctggcagcgattccgttctggtatctgatgacctttttgccctggcagctctac
tcgctggtggtgatgctggggatctgtatcggcgtctatctttgtcatcaaacggcgaaa
gacatgggtgtgcacgatcatggcagcattgtctgggacgaatttattggtatgtggatc
acgctcatggcgctgccgaccaatgactggcagtgggttgccgccgggtttgtgattttc
cgtattctggatatgtggaagccgtggccgatccgctggtttgatcgcaatgtgcatggc
ggcatggggatcatgatcgacgatattgtcgccggggtgatttccgcaggcatcctgtat
tttatcggtcatcactggccgctgggtattctgtcgtag
              
                            

Download fasta file
RegulonDB