RegulonDB RegulonDB 10.9: Gene Sequence
phnF gene sequence


Size: 726        A: 148  T: 129  G: 202  C: 247

Fasta

 

>phnF E. coli K12. Version NC_000913.3 GI:556503834
atgcacttgtctacacatccgaccagctacccaacacgctatcaagagatagccgcaaaa
cttgagcaggagcttcgtcaacactaccgctgcggcgactatcttcccgccgagcagcaa
ctggcagcgcgctttgaggtgaatcgccacaccctgcgccgcgccatcgaccaactggtg
gaaaaaggctgggtacagcgccgtcagggcgtcggcgtgctggtgctgatgcgcccgttc
gattacccgctcaacgcccaggcgcgttttagccagaatctgctggatcagggcagccat
cccaccagcgaaaaactgctttcggtattgcgccccgcgtccggccacgtcgctgacgca
ctggggattaccgagggggagaacgtcatccacctgcgcaccctgcgtcgtgtcaacggc
gtcgcgctctgtttaatcgaccactacttcgcggacctcaccctctggccgacgctgcaa
cgcttcgacagcggctcgctgcacgattttctgcgcgagcaaaccggaattgcgctgcgc
cgcagccagacgcggatcagcgcccgccgcgcccaggccaaagagtgccagcgtcttgaa
atcccgaatatgtcgccgctgctgtgcgtgcgcacccttaaccaccgtgacggtgaaagc
agcccggcggagtactccgtcagcctgacgcgcgccgacatgattgaattcactatggag
cactga
              
                            

Download fasta file
RegulonDB