RegulonDB RegulonDB 10.9: Gene Sequence
phoB gene sequence


Size: 690        A: 164  T: 150  G: 208  C: 168

Fasta

 

>phoB E. coli K12. Version NC_000913.3 GI:556503834
atggcgagacgtattctggtcgtagaagatgaagctccaattcgcgaaatggtctgcttc
gtgctcgaacaaaatggctttcagccggtcgaagcggaagattatgacagtgctgtgaat
caactgaatgaaccctggccggatttaattctcctcgactggatgttacctggcggctcc
ggtatccagttcatcaaacacctcaagcgcgagtcgatgacccgggatattccagtggtg
atgttgaccgccagaggggaagaagaagatcgcgtgcgcggccttgaaaccggcgcggat
gactatatcaccaagccgttttcgccgaaggagctggtggcgcgaatcaaagcggtaatg
cgccgtatttcgccaatggcggtggaagaggtgattgagatgcagggattaagtctcgac
ccgacatctcaccgagtgatggcgggcgaagagccgctggagatggggccgacagaattt
aaactgctgcacttttttatgacgcatcctgagcgcgtgtacagccgcgagcagctgtta
aaccacgtctggggaactaacgtgtatgtggaagaccgcacggtcgatgtccacattcgt
cgcctgcgtaaagcactggagcccggcgggcatgaccgcatggtgcagaccgtgcgcggt
acaggatatcgtttttcaacccgcttttaa
              
                            

Download fasta file
RegulonDB