RegulonDB RegulonDB 10.8: Gene Sequence
phoP gene sequence


Size: 672        A: 178  T: 173  G: 171  C: 150

Fasta

 

>phoP E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgtactggttgttgaagacaatgcgttgttacgtcaccaccttaaagttcagatt
caggatgctggtcatcaggtcgatgacgcagaagatgccaaagaagccgattattatctc
aatgaacatataccggatattgcgattgtcgatctcggattgccagacgaggacggtctg
tcactgattcgccgctggcgtagcaacgatgtttcactgccgattctggtattaaccgcc
cgtgaaagctggcaggacaaagtcgaagtattaagtgccggtgctgatgattatgtgact
aaaccgtttcatattgaagaggtgatggcgcgaatgcaggcattaatgcggcgtaatagc
ggtctggcttcacaggtcatttcgctccccccgtttcaggttgatctctctcgccgtgaa
ttatctattaatgacgaagtgatcaaactgaccgcgttcgaatacactattatggaaacg
ttgatacgcaataatggcaaagtggtcagcaaagattcgttaatgctccaactctatccg
gatgcggagctgcgggaaagccataccattgatgtactgatgggacgtctgcgcaaaaaa
attcaggcacaatatccccaagaagtgattaccaccgttcgcggccagggctatctgttc
gaattgcgctga
              
                            

Download fasta file
RegulonDB