RegulonDB RegulonDB 10.8: Gene Sequence
phoQ gene sequence


Size: 1461        A: 367  T: 344  G: 404  C: 346

Fasta

 

>phoQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattactgcgtctttttttcccgctctcgctgcgggtacgttttctgttggca
acggcagcggtagtactggtgctttcgcttgcctacggaatggtcgcgctgatcggttat
agcgtcagtttcgataaaactacgtttcggctgttacgtggcgagagcaatctgttctat
acccttgcgaagtgggaaaacaataagttgcatgtcgagttacccgaaaatatcgacaag
caaagccccaccatgacgctaatttatgatgagaacgggcagcttttatgggcgcaacgt
gacgtgccctggctgatgaagatgatccagcctgactggctgaaatcgaatggttttcat
gaaattgaagcggatgttaacgataccagcctcttgctgagtggagatcattcgatacag
caacagttgcaggaagtgcgggaagatgatgacgacgcggagatgacccactcggtggca
gtaaacgtctacccggcaacatcgcggatgccaaaattaaccattgtggtggtggatacc
attccggtggagctaaaaagttcctatatggtctggagctggtttatctatgtgctctca
gccaatctgctgttagtgatcccgctgctgtgggtcgccgcctggtggagtttacgcccc
atcgaagccctggcaaaagaagtccgcgaactggaagaacataaccgcgaattgctcaat
ccagccacaacgcgagaactgaccagtctggtacgaaacctgaaccgattgttaaaaagt
gaacgcgaacgttacgacaaataccgtacgacgctcaccgacctgacccatagtctgaaa
acgccactggcggtgctgcaaagtacgctgcgttctctgcgtagtgaaaagatgagcgtc
agtgatgctgagccggtaatgctggagcaaatcagccgcatttcacagcaaattggctac
tacctgcatcgtgccagtatgcgcggcgggacattgctcagccgcgagctgcatccggtc
gccccactgctggacaatctcacctcagcgctgaacaaagtgtatcaacgcaaaggggtc
aatatctctctcgatatttcgccagagatcagctttgtcggtgagcagaacgattttgtc
gaggtgatgggcaacgtgctggataatgcctgtaaatattgcctcgagtttgtcgaaatt
tctgcaaggcaaaccgacgagcatctctatattgtggtcgaggatgatggccccggtatt
ccattaagcaagcgagaggtcattttcgaccgtggtcaacgggttgatactttacgccct
gggcaaggtgtagggctggcggtagcccgcgaaatcaccgagcaatatgagggtaaaatc
gtcgccggagagagcatgctgggcggtgcgcggatggaggtgatttttggtcgccagcat
tctgcgccgaaagatgaataa
              
                            

Download fasta file
RegulonDB